-
Laser Surface Texture for Improvement of Modular Design
Issue:
Volume 3, Issue 1, March 2022
Pages:
1-4
Received:
19 September 2021
Accepted:
9 December 2021
Published:
24 January 2022
DOI:
10.11648/j.advances.20220301.11
Downloads:
Views:
Abstract: Laser surface textures can have various geometries and dimensions. These can be placed on a portion or the entire product. This can be change the contact between the surfaces. To reduce or increase the tensile, compressive and angular loads. In some surfaces it is recommended that a portion is used based on the dimensions of the product. The geometries can use the entire dimensions. This chosen using the load change that occurs when many surfaces contact in the product. The load change can be instantaneous or occur gradually. This produces a much greater corrosion when in contact between the surfaces. The surface texture layers can be used on particular or both surfaces. The interparticle distance are much greater that each size. The benefits include changing properties. The surfaces are liquefied in the direction of the load. This improves the contact area between the particles. This can be modular or on the entire surface. The laser produces a high solidification rate of particle. This contributes to the performance of the product. To resist corrosion of the surface. This depends on the liquification and modular design. Surface textures are a continuous geometrical path. These are usually designed as contact heights and widths. These have a distance that is equal to the processing time or duration of the laser and the dimensions of the product. The geometrical path has a distance in the horizontal and vertical directions. Lasers have the benefit that these can process with high efficiency geometries. In the research products were processed with various shapes and dimensions.
Abstract: Laser surface textures can have various geometries and dimensions. These can be placed on a portion or the entire product. This can be change the contact between the surfaces. To reduce or increase the tensile, compressive and angular loads. In some surfaces it is recommended that a portion is used based on the dimensions of the product. The geomet...
Show More
-
Adaptive Capacity of Dairy Farmers in Ziway-Shashemene Milkshed, Ethiopia
Mina Mehdi Hassn,
Leonoor Akkermans
Issue:
Volume 3, Issue 1, March 2022
Pages:
5-10
Received:
4 January 2022
Accepted:
22 January 2022
Published:
5 February 2022
DOI:
10.11648/j.advances.20220301.12
Downloads:
Views:
Abstract: Ethiopia has the largest livestock population in Africa where cattle production is high. Among the cattle production, Dairy farming is a source of livelihood for many Ethiopians. Further, Dairy farming is crucial in providing income, food, and creating job opportunities for many people in Ethiopia. Understanding of dairy farmer’s capabilities and capitals are important in order to achieve the desired life outcomes. Therefore, the study aimed to answer dairy farmers vulnerability context and Capitals/ assets that affects their adaptive capacity. The study was conducted in Ziway-Shashemene milk shed of Ethiopia where a descriptive research design was conducted where a case study was carried out to assess the adaptive capacity of farmers especially on their livelihood assets and factors affecting in the production of dairy farms through qualitative research methods. The study shows that dairy farmers face different challenges especially on feed unavailability, high feed price, milk and milk product price fluctuation, climate change, unavailability of land for pasture or planting forage, and disease and death of dairy cattle. In order to cope with those challenges they use various adaptive measures by using their indigenous knowledge and experience. However, Physical, financial, human, natural, and social capital of dairy farmers in the milk shed is limited, which is not enough to cope with vulnerability which negatively affects their adaptive capacity.
Abstract: Ethiopia has the largest livestock population in Africa where cattle production is high. Among the cattle production, Dairy farming is a source of livelihood for many Ethiopians. Further, Dairy farming is crucial in providing income, food, and creating job opportunities for many people in Ethiopia. Understanding of dairy farmer’s capabilities and c...
Show More
-
Practice and Challenges of Sport Facility Management in Nekemte Town
Chaltu Shuma,
Alemayehu Ijigu
Issue:
Volume 3, Issue 1, March 2022
Pages:
11-15
Received:
10 January 2022
Accepted:
26 January 2022
Published:
16 February 2022
DOI:
10.11648/j.advances.20220301.13
Downloads:
Views:
Abstract: Sports facilities are referred to as mainly the immovable structures for sport practice, maintenance, repair and health, in which safety issues should be considered by authorities. However, there has been insufficient research to determine how well practice and challenges in sports facility management have been carried out in Ethiopia, as well as in western Oromia, East wollega zone in Nekemte town. As a result, the purpose of this study is to look in to the practice and challenges of sport facility management in the Nekemte of town. The main objective of this study was to assess the practice and challenges of sport facility management in Nekemte town. The descriptive survey approach was used in this study. The total population of this study were 84, 69 males and 15 females. The researcher used the available purposive sampling technique for all respondents, because of they were directly concerned with the issues under discussion and also they are few in number, so all of them were included in these study. Questionnaires, interviews and observations were used to gather data from sample respondents. The thesis employs both quantitative and qualitative data processing methods. SPSS (v-24) was used to analyze the quantitative data, tables, percentages, and frequency, to calculate on the base responses of the respondents. Qualitative data is analyzed by using words. Based on data analyzed, the following findings were obtained. According to the response gained about challenges, the current result revealed that Marjorie’s of respondents 50 (85%) of respondents, there was challenges in sport facility management particularly in stadium in Nekemte town, when explained their idea as the following, lack of employee experience, lack of coordination from top level to low level, Budget and financial constraints. To overcome these challenges, the following recommendations have been forwarded, Nekemte town admistration should approve the budget for the sports facilities in Nekemte tow, give training for sport employees, and sport facility employees should be give high attention for football stadium.
Abstract: Sports facilities are referred to as mainly the immovable structures for sport practice, maintenance, repair and health, in which safety issues should be considered by authorities. However, there has been insufficient research to determine how well practice and challenges in sports facility management have been carried out in Ethiopia, as well as i...
Show More
-
Review on Economic Efficiency of Vegetable Production in Ethiopia
Dagmawe Menelek Asfaw,
Abdurhman Kedir Ali
Issue:
Volume 3, Issue 1, March 2022
Pages:
16-24
Received:
26 December 2021
Accepted:
5 February 2022
Published:
28 February 2022
DOI:
10.11648/j.advances.20220301.14
Downloads:
Views:
Abstract: Vegetables are important as a source of micronutrients for human nutrition, a means of income, food security, employment, and foreign exchange. In Ethiopia, most of the soil types suited for fruits and vegetables producing regions of the country range from light clay to loam and are well suited for horticultural production. However, the production in Ethiopia does not meet the need of the country's population for vegetable products, and/or the production levels of vegetables are still far below their potential, in general, there was inefficiency in the production of vegetables. The main objective of this paper was to review the determinant and level of vegetable efficiencies in Ethiopia. Based on the reviewing of the studies, basic determinants of vegetable efficiencies in Ethiopia were:- age, sex, education, family size, ownership of livestock, experience, frequency of extension contact, training, membership in a farmers’ association, participation in off/non-farm income, credit access, land fragmentation, seed type, farm to home distance, distance to the nearest market and soil fertility, access to transportation, land slope and distance to extension service. The level of technical, allocative, and economic efficiencies was highly variable between vegetable farmers and the mean level of all efficiencies-all most below the required level (inefficient). Based on such findings we have been recommended:- enhance farmer education, offer training and extension service, provide access to credit, encourage the farmer to participated in off-farm income and farmer association members, built market, extension service, and farmer training center around.
Abstract: Vegetables are important as a source of micronutrients for human nutrition, a means of income, food security, employment, and foreign exchange. In Ethiopia, most of the soil types suited for fruits and vegetables producing regions of the country range from light clay to loam and are well suited for horticultural production. However, the production ...
Show More
-
Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria
Ismail Muhammad,
Pukuma Micah Sale,
Augustine Linda Midala
Issue:
Volume 3, Issue 1, March 2022
Pages:
25-33
Received:
6 February 2022
Accepted:
24 February 2022
Published:
9 March 2022
DOI:
10.11648/j.advances.20220301.15
Downloads:
Views:
Abstract: Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the status of some biomarkers of Artemisisnin resistance in K13 Propeller gene of Plasmodium falciparum from Gombe L.G.A. Nigeria. 200 blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA was determined using Nanodrop Spectrophotometer. 57 true positive samples were selected and used for molecular analysis. Nested PCR was used to amplify required codon (M442V, N554S, A569S and A578S) portion of K13 the gene. Both Primary and Secondary PCR were carried out in 25µl containing DNA template 5µl, distilled water 6.5µl, 0.5µl each of the forward and reverse primer (F5’GGGAATCTGGTGGTAAACAGC3’ and R5’CGGAGTGACCAAATCTGGGA3’for primary PCR, F5’GCCTTGTTGAAAGAAGCAGA3’ and GCCAAGCTGCCATTCATTTG3’ for Nested PCR) and 12.5µl Master mix. Thermocyclic were set as 95°C for 2minute (initial denaturation), followed by 35 cycles at 95°C for 45seconds denaturation, 57°C for 20s, Annealing 60°C for 150s extension and final extension at 60°C for 10min, while for secondary PCR was 95°C for 1min, followed by 35 cycles at 95°C for 30s, 55°C for 20s, 60°C for 60s and final extension at 60°C for 10minute. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, afterwhich the sequenced products were subjected to BLAST software. All the fifty seven sequenced amplicon were found to be wild type. All isolate of Plasmodium falciparum used in the study were sensitive to ACTs from Further research should be carried out using large sample size and also targeting other bio makers of artemisisnin resistance associated with K13.
Abstract: Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the statu...
Show More
