Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the status of some biomarkers of Artemisisnin resistance in K13 Propeller gene of Plasmodium falciparum from Gombe L.G.A. Nigeria. 200 blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA was determined using Nanodrop Spectrophotometer. 57 true positive samples were selected and used for molecular analysis. Nested PCR was used to amplify required codon (M442V, N554S, A569S and A578S) portion of K13 the gene. Both Primary and Secondary PCR were carried out in 25µl containing DNA template 5µl, distilled water 6.5µl, 0.5µl each of the forward and reverse primer (F5’GGGAATCTGGTGGTAAACAGC3’ and R5’CGGAGTGACCAAATCTGGGA3’for primary PCR, F5’GCCTTGTTGAAAGAAGCAGA3’ and GCCAAGCTGCCATTCATTTG3’ for Nested PCR) and 12.5µl Master mix. Thermocyclic were set as 95°C for 2minute (initial denaturation), followed by 35 cycles at 95°C for 45seconds denaturation, 57°C for 20s, Annealing 60°C for 150s extension and final extension at 60°C for 10min, while for secondary PCR was 95°C for 1min, followed by 35 cycles at 95°C for 30s, 55°C for 20s, 60°C for 60s and final extension at 60°C for 10minute. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, afterwhich the sequenced products were subjected to BLAST software. All the fifty seven sequenced amplicon were found to be wild type. All isolate of Plasmodium falciparum used in the study were sensitive to ACTs from Further research should be carried out using large sample size and also targeting other bio makers of artemisisnin resistance associated with K13.
| Published in | Advances (Volume 3, Issue 1) |
| DOI | 10.11648/j.advances.20220301.15 |
| Page(s) | 25-33 |
| Creative Commons |
This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited. |
| Copyright |
Copyright © The Author(s), 2022. Published by Science Publishing Group |
Gombe, K13 Propeller Gene, Resistance, Artemisisnin, Plasmodium falciparum
| [1] | Abdulrazaq, A., Abdulkadi, B., Isyaku, N. T., Yahaya, M., Badru, O. A., & Alkali, K. (2020). In Vitro Antimalarial Activity of Extracts of Some Indigenous Plant Species in Kebbi State. Umar musa yar'aduwa journal of Microbiology Research 5 (2), 1–10. |
| [2] | Abubakar, U. F., Adam, R., Mukhtar, M. M., Muhammad, A., Yahuza, A. A., & Ibrahim, S. S. (2020). Identification of Mutations in Antimalarial Resistance Gene Kelch13 from Plasmodium falciparum Isolates in Kano, Nigeria. Tropical Medicine and Infectious Disease, 5 (2). https://doi.org/10.3390/tropicalmed5020085. |
| [3] | Adamu, A., Jada, M. S., Mohammed, H., Haruna, S., Yakubu, B. O., Ibrahim, M. A., Balogun, E. O., Sakura, T., Inaoka, D. K., Kita, K., Hirayama, K., Culleton, R., & Shuaibu, M. N. (2020). Plasmodium falciparum multidrug resistance gene - 1 polymorphisms in Northern Nigeria: implications for the continued use of artemether - lumefantrine in the region. Malaria Journal, 1–10. https://doi.org/10.1186/s12936-020-03506-z. |
| [4] | Afolabi, O. J., & Abejide, A. E. (2020). Antiplasmodial activities of Morinda lucida (Benth) and Alstonia boonei (De wild) in mice infected with Plasmodium berghei. Bulletin of the National Research Centre 44: 85. |
| [5] | Ahouidi, A., Oliveira, R., Lobo, L., Diedhiou, C., Mboup, S., & Nogueira, F. (2021). Prevalence of pfk13 and Pfmdr1 polymorphisms in Bounkiling, Southern Senegal. PLoS ONE, 16 (3 March), 1–11. https://doi.org/10.1371/journal.pone.0249357. |
| [6] | Ajayi, N. A., & Ukwaja, K. N. (2013). Possible artemisinin-based combination therapy-resistant malaria in Nigeria: A report of three cases. Revista Da Sociedade Brasileira de Medicina Tropical, 46 (4), 525–527. https://doi.org/10.1590/0037-8682-0098-2013. |
| [7] | Arya, A., Foko, L. P. K., Chaudhry, S., Sharma, A., & Singh, V. (2021). Drugs and Drug Resistance Artemisinin-based Combination Therapy (ACT) and drug resistance molecular markers: A systematic review of clinical studies from two malaria endemic regions – India and sub-Saharan Africa. International Journal for Parasitology: 15, 43–56. |
| [8] | Brown, T. S., Jacob, C. G., Silva, J. C., Takala-Harrison, S., Djimdé, A., Dondorp, A. M., Fukuda, M., Noedl, H., Nyunt, M. M., Kyaw, M. P., Mayxay, M., Hien, T. T., Plowe, C. V., & Cummings, M. P. (2015). Plasmodium falciparum field isolates from areas of repeated emergence of drug resistant malaria show no evidence of hypermutator phenotype. Infection, Genetics and Evolution, 30, 318–322. https://doi.org/10.1016/j.meegid.2014.12.010. |
| [9] | Demas, A. R., Sharma, A. I., Wong, W., Early, A. M., Redmond, S., Bopp, S., Neafsey, D. E., Volkman, S. K., Hartl, D. L., & Wirth, D. F. (2018). Mutations in Plasmodium falciparum actin-binding protein coronin confer reduced artemisinin susceptibility. Proceedings of the National Academy of Sciences of the United States of America, 115 (50), 12799–12804. https://doi.org/10.1073/pnas.1812317115. |
| [10] | Elshafey, O. K., & El-ghaffar, M. M. A. B. D. (2021). Sequence Analysis of K13 Propeller Gene Polymorphism of Plasmodium falciparum -Infected Patients In Egypt. Journal of the Egyptian Society of Parasitology,. 51 (3), 423–430. |
| [11] | Federal Ministry of Health (2018). Therapeutic Efficacy Study Of Artemether- Lumefantrine, Artesunate-Amodiaquine, And Dihydroartemisinin-Piperaquine For The Treatment of Uncomplicated Plasmodium falciparum Malaria In Nigerian Children. |
| [12] | Ghanchi, N. K., Qurashi, B., Raees, H., & Beg, M. A. (2021). Molecular surveillance of drug resistance: Plasmodium falciparum artemisinin resistance single nucleotide polymorphisms in Kelch protein propeller (K13) domain from Southern Pakistan. Malaria Journal, 20 (1). https://doi.org/10.1186/s12936-021-03715-0. |
| [13] | He, Y., Campino, S., Diez, E., Id, B., Warhurst, D. C., Beshir, B., Lubis, I., Gomes, A. R., Feng, J., Jiazhi, W., Sun, X., Huang, F., Tang, L., Id, C. J. S., & Id, T. G. C. (2019). Artemisinin resistance-associated markers in Plasmodium falciparum parasites from the China-Myanmar border: predicted structural stability of K13 propeller variants detected in a low-prevalence area. PLoS ONE 14 (3): e0213686. https://doi.org/ 10.1371/journal.pone.02136861–13. |
| [14] | Huang, B., Deng, C., Yang, T., Xue, L., Wang, Q., Huang, S., Su, X. Z., Liu, Y., Zheng, S., Guan, Y., Xu, Q., Zhou, J., Yuan, J., Bacar, A., Abdallah, K. S., Attoumane, R., Mliva, A. M. S. A., Zhong, Y., Lu, F., & Song, J. (2015). Polymorphisms of the artemisinin resistant marker (K13) in Plasmodium falciparum parasite populations of Grande Comore Island 10 years after artemisinin combination therapy. Parasites and Vectors, 8 (1), 1–8. https://doi.org/10.1186/s13071-015-1253-z. |
| [15] | Idowu, A. O., Bhattacharyya, S., Gradus, S., Oyibo, W., George, Z., Black, C., Igietseme, J., & Azenabor, A. A. (2018). Plasmodium falciparum treated with artemisinin-based combined therapy exhibits enhanced mutation, heightened cortisol and TNF-α induction. International Journal of Medical Sciences, 15 (13), 1449–1457. https://doi.org/10.7150/ijms.27350. |
| [16] | Kayiba, N. K., Yobi, D. M., Tshibangu-Kabamba, E., Tuan, V. P., Yamaoka, Y., Devleesschauwer, B., Mvumbi, D. M., Okitolonda Wemakoy, E., De Mol, P., Mvumbi, G. L., Hayette, M. P., Rosas-Aguirre, A., & Speybroeck, N. (2021). Spatial and molecular mapping of Pfkelch13 gene polymorphism in Africa in the era of emerging Plasmodium falciparum resistance to artemisinin: a systematic review. The Lancet Infectious Diseases, 21 (4), e82–e92. https://doi.org/10.1016/S1473-3099(20)30493-X. |
| [17] | Khaja, K. A. J. Al, & Sequeira, R. P. (2021). Drug treatment and prevention of malaria in pregnancy: a critical review of the guidelines. Malaria Journal, 20: 62 1–13. https://doi.org/10.1186/s12936-020-03565-2. |
| [18] | Laminou, I. M., Lamine, M. M., & Arzika, I. (2018). Detection of Plasmodium falciparum K13 Propeller A569G Mutation after Detection of Plasmodium falciparum K13 Propeller A569G Mutation after Artesunate-amodiaquine Treatment Failure in Niger. Journal of Advances in Biology & Biotechnology. 18 (2): 1-8. |
| [19] | Mac, P. A., Hussaini Fatima Asheadzi, Amuga Gideon, P. T. and P., & Airiohuodion. (2019). Prevalence of Plasmodium falciparum among Nigerians in Abuja and Central States: A Comparative Analysis of Sensitivity and Specificity Using Rapid Diagnostic Test and Microscopy as Tools in Management of Malaria. International Journal of Tropical Diseases, 2 (1), 2–7. |
| [20] | Mahamat Souleymane, I., Hinzoumbé Clément, K., Modobé Denis, M., Aristide Berenger, A., Baba, C., André Offianan, T., Mbanga, D., Passiri, T., Honoré, D., Jean Marie, Y. V, Samir, B., Pascal, R., Mireille, D., & Allico Joseph, D. (2017). Therapeutic Efficacy of Artesunate-Amodiaquine and Polymorphism of Plasmodium falciparumk13-Propeller Gene in Pala (Tchad). International Journal of Open Access and Clinical Trials, 1 (1), 1–6. www.symbiosisonlinepublishing.com. |
| [21] | Mathieu, L. C., Cox, H., Early, A. M., Mok, S., Lazrek, Y., Paquet, J., Ade, M., Lucchi, N. W., Grant, Q., Udhayakumar, V., Alexandre, J. S. F., Demar, M., Ringwald, P., Neafsey, D. E., & Fidock, D. A. (2020). Local emergence in Amazonia of Plasmodium falciparum k13 C580Y mutants associated with in vitro artemisinin resistance. Elife, 1–21. |
| [22] | Ménard, D., Khim, N., Beghain, J., Adegnika, A. A., Shafiul-Alam, M., Amodu, O., Rahim-Awab, G., Barnadas, C., Berry, A., Boum, Y., Bustos, M. D., Cao, J., Chen, J.-H., Collet, L., Cui, L., Thakur, G.-D., Dieye, A., Djallé, D., Dorkenoo, M. A., … Mercereau-Puijalon, O. (2016). A Worldwide Map of Plasmodium falciparum K13-Propeller Polymorphisms. New England Journal of Medicine, 374 (25), 2453–2464. https://doi.org/10.1056/nejmoa1513137. |
| [23] | Miotto, O., Amato, R., Ashley, E. A., Macinnis, B., Almagro-Garcia, J., Amaratunga, C., Lim, P., Mead, D., Oyola, S. O., Dhorda, M., Imwong, M., Woodrow, C., Manske, M., Stalker, J., Drury, E., Campino, S., Amenga-Etego, L., Thanh, T. N. N., Tran, H. T., … Kwiatkowski, D. P. (2015). Genetic architecture of artemisinin-resistant Plasmodium falciparum. Nature Genetics, 47 (3), 226–234. https://doi.org/10.1038/ng.3189. |
| [24] | Muhammad, I. (2020). Molecular mechanism of erythrocytic invasion by the merozoite stage of Plasmodium. Journal of Pure and Applied Sciences. 21 (2021), 130–137. |
| [25] | Nyawira Wangai, L., Kimani Kamau, K., Marwa, I., OMunde, E., Mburu, S., Mwangi, J., Webale, M., Butto, D., Kamau, L., & Hiuhu, J. (2020). Distribution and Contribution of K13-propeller Gene to Artemisinin Resistance in sub-Saharan Africa: A Systematic Review. Biomedical Sciences, 6 (2), 38. https://doi.org/10.11648/j.bs.20200602.14. |
| [26] | Ocan, M., Akena, D., Nsobya, S., Kamya, M. R., Senono, R., & Kinengyere, A. A. (2019). K13 - propeller gene polymorphisms in Plasmodium falciparum parasite population in malaria affected countries: a systematic review of prevalence and risk factors. Malaria Journal, 1–17. https://doi.org/10.1186/s12936-019-2701-6. |
| [27] | Okafor, A. I., & Nok, A. J. (2013). Antiplasmodial Activity of Aqueous leaf Extract of Mucuna Pruriens Linn in Mice Infected with Plasmodium Berghei (Nk-65 Strain). Journal of Applied Pharmaceutical Science. 3 (4 Suppl 1), S52-S55, https://doi.org/10.7324/JAPS.2013.34.S9. |
| [28] | Olasehinde, G. I., Diji-Geske, R. I., Fadina, I., Arogundade, D., Darby, P., Adeleke, A., Dokunmu, T. M., Adebayo, A. H., & Oyelade, J. (2019). Epidemiology of Plasmodium falciparum infection and drug resistance markers in ota area, southwestern Nigeria. Infection and Drug Resistance, 12, 1941–1949. https://doi.org/10.2147/IDR.S190386. |
| [29] | Owoloye, A., Olufemi, M., Idowu, E. T., & Oyebola, K. M. (2021). Prevalence of potential mediators of artemisinin resistance in African isolates of Plasmodium falciparum. Malaria Journal, 20 (1), 1–12. https://doi.org/10.1186/s12936-021-03987-6. |
| [30] | Putaporntip, C., Kuamsab, N., Kosuwin, R., Tantiwattanasub, W., Vejakama, P., Sueblinvong, T., Seethamchai, S., Jongwutiwes, S., & Hughes, A. L. (2016). Natural selection of K13 mutants of Plasmodium falciparum in response to artemisinin combination therapies in Thailand. Clinical Microbiology and Infection, 22 (3), 285. e1-285. e8. https://doi.org/10.1016/j.cmi.2015.10.027. |
| [31] | Sharma, S., Bharti, R. S., Bhardwaj, N., Anvikar, A. R., Valecha, N., & Mishra, N. (2017). Correlation of in vitro sensitivity of chloroquine and other antimalarials with the partner drug resistance to Plasmodium falciparum malaria in selected sites of India. Indian Journal of Medical Microbiology, 35 (4), 485–490. https://doi.org/10.4103/ijmm.IJMM_17_160. |
| [32] | Stauffer, W., & Fischer, P. R. (2003). Diagnosis and Treatment of Malaria in Children. Clinical infectious disease. 1340-1348. |
| [33] | Stokes, B. H., Dhingra, S. K., Rubiano, K., Mok, S., Straimer, J., Gnädig, N. F., Deni, I., Schindler, K. A., Bath, J. R., Ward, K. E., Striepen, J., Yeo, T., Ross, L. S., Legrand, E., Ariey, F., Cunningham, C. H., Souleymane, I. M., Gansané, A., Nzoumbou-Boko, R., … Fidock, D. A. (2021). Plasmodium falciparum k13 mutations in africa and asia impact artemisinin resistance and parasite fitness. ELife, 10, 1–29. https://doi.org/10.7554/eLife.66277. |
| [34] | Takala-Harrison, S., Clark, T. G., Jacob, C. G., Cummings, M. P., Miotto, O., Dondorpe, A. M., Fukuda, M. M., Nosten, F., Noedl, H., Imwong, M., Bethell, D., Se, Y., Lon, C., Tyner, S. D., Saunders, D. L., Socheat, D., Ariey, F., Phyo, A. P., Starzengruber, P., … Plowe, C. V. (2013). Genetic loci associated with delayed clearance of Plasmodium falciparum following artemisinin. Proceedings of the National Academy of Sciences of the United States of America, 110 (1), 240–245. https://doi.org/10.1073/pnas.1211205110. |
| [35] | Taylor, S. M., Parobek, C. M., De Conti, D. K., Kayentao, K., Coulibaly, S. O., Greenwood, B. M., Tagbor, H., Williams, J., Bojang, K., Njie, F., Desai, M., Kariuki, S., Gutman, J., Mathanga, D. P., Mårtensson, A., Ngasala, B., Conrad, M. D., Rosenthal, P. J., Tshefu, A. K.,… Juliano, J. J. (2015). Absence of putative artemisinin resistance mutations among Plasmodium falciparum in sub-Saharan Africa: A molecular epidemiologic study. Journal of Infectious Diseases, 211 (5), 680–688. https://doi.org/10.1093/infdis/jiu467. |
| [36] | Thuy-Nhien, N., Tuyen, N. K., Tong, N. T., Vy, N. T., Thanh, N. V., Van, H. T., Huong-Thu, P., Quang, H. H., Boni, M. F., Dolecek, C., Farrar, J., Thwaites, G. E., Miotto, O., White, N. J., & Hien, T. T. (2017). K13 propeller mutations in Plasmodium falciparum populations in regions of malaria endemicity in Vietnam from 2009 to 2016. Antimicrobial Agents and Chemotherapy, 61 (4). https://doi.org/10.1128/AAC.01578-16. |
| [37] | Tjitraresmi, A., Moektiwardoyo, M., Susilawati, Y., & Shiono, Y. (2020). Antimalarial Activity of Lamiaceae Family Plants: Review. Systematic Reviews in Pharmacy 11 (7), 324–333. |
| [38] | Toure, O. A., Landry, T. N., Assi, S. B., Kone, A. A., Gbessi, E. A., Ako, B. A., Coulibaly, B., Kone, B., Ouattara, O., Beourou, S., Koffi, A., Remoue, F., & Rogier, C. (2018). Malaria parasite clearance from patients following artemisinin-based combination therapy in Côte D’Ivoire. Infection and Drug Resistance, 11, 2031–2038. https://doi.org/10.2147/IDR.S167518. |
| [39] | Voumbo-Matoumona, D. F., Kouna, L. C., Madamet, M., Maghendji-Nzondo, S., Pradines, B., & Lekana-Douki, J. B. (2018). Prevalence of Plasmodium falciparum antimalarial drug resistance genes in southeastern Gabon from 2011 to 2014. Infection and Drug Resistance, 11, 1329–1338. https://doi.org/10.2147/IDR.S160164. |
| [40] | Wang, X., Ruan, W., Zhou, S., Huang, F., Lu, Q., Feng, X., & Yan, H. (2020). Molecular surveillance of Pfcrt and k13 propeller polymorphisms of imported Plasmodium falciparum cases to Zhejiang Province, China between 2016 and 2018. Malaria Journal, 1–9. https://doi.org/10.1186/s12936-020-3140-0. |
| [41] | Welle, S. C., Ajumobi, O., Dairo, M., Balogun, M., Adewuyi, P., Adedokun, B., Nguku, P., Gidado, S., & Ajayi, I. (2019). Preference for Artemisinin – based combination therapy among healthcare. Global Health Research and Policy, 9, 1–8. |
| [42] | WHO. (2018). Artemisinin resistance and artemisinin-based combination therapy efficacy. http://apps.who.int/iris/handle/10665/274362. |
| [43] | YobiI, D. M., Nadine Kalenda Kayiba, D. M. M., & Raphael Boreux, Sebastien Bontems, Pius Zakayi Kabututu1, Patrick De Mol, Niko Speybroeck, Georges Lelo Mvumbi1, M.-P. H. (2020). The lack of K13-propeller mutations associated with artemisinin resistance in Plasmodium falciparum in Democratic Republic of Congo (DRC). PLoS ONE, 15 (8): e02 (August). https://doi.org/10.1371/journal.pone.0237791. |
APA Style
Ismail Muhammad, Pukuma Micah Sale, Augustine Linda Midala. (2022). Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria. Advances, 3(1), 25-33. https://doi.org/10.11648/j.advances.20220301.15
ACS Style
Ismail Muhammad; Pukuma Micah Sale; Augustine Linda Midala. Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria. Advances. 2022, 3(1), 25-33. doi: 10.11648/j.advances.20220301.15
Share This Article
Twitter
Linked In
Facebook
Copy
Download@article{10.11648/j.advances.20220301.15,
author = {Ismail Muhammad and Pukuma Micah Sale and Augustine Linda Midala},
title = {Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria},
journal = {Advances},
volume = {3},
number = {1},
pages = {25-33},
doi = {10.11648/j.advances.20220301.15},
url = {https://doi.org/10.11648/j.advances.20220301.15},
eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.advances.20220301.15},
abstract = {Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the status of some biomarkers of Artemisisnin resistance in K13 Propeller gene of Plasmodium falciparum from Gombe L.G.A. Nigeria. 200 blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA was determined using Nanodrop Spectrophotometer. 57 true positive samples were selected and used for molecular analysis. Nested PCR was used to amplify required codon (M442V, N554S, A569S and A578S) portion of K13 the gene. Both Primary and Secondary PCR were carried out in 25µl containing DNA template 5µl, distilled water 6.5µl, 0.5µl each of the forward and reverse primer (F5’GGGAATCTGGTGGTAAACAGC3’ and R5’CGGAGTGACCAAATCTGGGA3’for primary PCR, F5’GCCTTGTTGAAAGAAGCAGA3’ and GCCAAGCTGCCATTCATTTG3’ for Nested PCR) and 12.5µl Master mix. Thermocyclic were set as 95°C for 2minute (initial denaturation), followed by 35 cycles at 95°C for 45seconds denaturation, 57°C for 20s, Annealing 60°C for 150s extension and final extension at 60°C for 10min, while for secondary PCR was 95°C for 1min, followed by 35 cycles at 95°C for 30s, 55°C for 20s, 60°C for 60s and final extension at 60°C for 10minute. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, afterwhich the sequenced products were subjected to BLAST software. All the fifty seven sequenced amplicon were found to be wild type. All isolate of Plasmodium falciparum used in the study were sensitive to ACTs from Further research should be carried out using large sample size and also targeting other bio makers of artemisisnin resistance associated with K13.},
year = {2022}
}
TY - JOUR T1 - Absence of Biomakers of Resistance in K13 Propeller Gene of Plasmodium falciparum from Gombe L.G.A of Gombe State, Nigeria AU - Ismail Muhammad AU - Pukuma Micah Sale AU - Augustine Linda Midala Y1 - 2022/03/09 PY - 2022 N1 - https://doi.org/10.11648/j.advances.20220301.15 DO - 10.11648/j.advances.20220301.15 T2 - Advances JF - Advances JO - Advances SP - 25 EP - 33 PB - Science Publishing Group SN - 2994-7200 UR - https://doi.org/10.11648/j.advances.20220301.15 AB - Malaria is still one of the life threatening parasitic disease in Sub-Saharan Africa. The causative agent of the disease always provide a means of avoiding the action of most commonly recommended drugs like Artemisinin based Combination Therapy (ACTs) through development of resistance. The aim of this surveillance study was to investigate the status of some biomarkers of Artemisisnin resistance in K13 Propeller gene of Plasmodium falciparum from Gombe L.G.A. Nigeria. 200 blood samples were collected from consented study subjects and analysed using Microscopy, RDT and PCR. DNA was extracted using Quick-DNA™ Miniprep (No. D4069), Purity and Concentration of the DNA was determined using Nanodrop Spectrophotometer. 57 true positive samples were selected and used for molecular analysis. Nested PCR was used to amplify required codon (M442V, N554S, A569S and A578S) portion of K13 the gene. Both Primary and Secondary PCR were carried out in 25µl containing DNA template 5µl, distilled water 6.5µl, 0.5µl each of the forward and reverse primer (F5’GGGAATCTGGTGGTAAACAGC3’ and R5’CGGAGTGACCAAATCTGGGA3’for primary PCR, F5’GCCTTGTTGAAAGAAGCAGA3’ and GCCAAGCTGCCATTCATTTG3’ for Nested PCR) and 12.5µl Master mix. Thermocyclic were set as 95°C for 2minute (initial denaturation), followed by 35 cycles at 95°C for 45seconds denaturation, 57°C for 20s, Annealing 60°C for 150s extension and final extension at 60°C for 10min, while for secondary PCR was 95°C for 1min, followed by 35 cycles at 95°C for 30s, 55°C for 20s, 60°C for 60s and final extension at 60°C for 10minute. The PCR products were subjected to electrophoresis in 2% agarose and stained with ethidium bromide. The amplicons were purified and sequenced, afterwhich the sequenced products were subjected to BLAST software. All the fifty seven sequenced amplicon were found to be wild type. All isolate of Plasmodium falciparum used in the study were sensitive to ACTs from Further research should be carried out using large sample size and also targeting other bio makers of artemisisnin resistance associated with K13. VL - 3 IS - 1 ER -
Information
Email: