Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm)

Osuntokun Oludare Temitope; Yusuf-Babatunde Moruf Ademola; Fapohunda Juliet Bisola

doi:doi:10.11648/j.jdmp.20261202.11

Research Article |

| Peer-Reviewed

Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm)

Osuntokun Oludare Temitope^*

, Yusuf-Babatunde Moruf Ademola

, Fapohunda Juliet Bisola

Published in Journal of Diseases and Medicinal Plants (Volume 12, Issue 2)

Received: 19 February 2026 Accepted: 3 March 2026 Published: 13 April 2026

Views: Downloads:

Download PDF

Share This Article

Twitter
Linked In
Facebook

Abstract

This study investigated the comparative effects of natural and chemical treatments on pond water samples obtained from the AAUA Fishery, with emphasis on microbial load reduction, diversity, antibiotic susceptibility, fungal occurrence, and molecular resistance gene detection. Treatments applied included Moringa oleifera leaf powder (0.5 g and 1 g), chlorine (0.5 g and 1 g), and direct sunlight exposure, while untreated samples served as controls. Microbiological analyses were performed using serial dilution, spread plating, colony morphology, Gram staining, and biochemical characterization, with bacterial identification supported by Bergey’s Manual of Determinative Bacteriology. Fungal isolates were identified based on cultural and microscopic features, and antibiotic susceptibility was assessed using the Kirby–Bauer disk diffusion method. PCR amplification was used to detect selected antibiotic resistance genes. Results showed that 0.5 g of Moringa moderately reduced bacterial counts from 3.5 × 10⁴ to 7.0 × 10³ CFU/mL (10^-3 dilution) and from 2.0 × 10⁷ to 6.0 × 10⁶ CFU/mL (10^-6 dilution) over 6 h, while 1 g produced weaker inhibition. Sunlight treatment was more effective, lowering bacterial load from 6.0 × 10⁴ to 7.0 × 10³ CFU/mL and from 3.5 × 10⁷ to 4.0 × 10⁶ CFU/mL across dilutions. Chlorine was the most potent treatment, achieving complete elimination of bacterial growth within 4–6 h at both concentrations. Control samples only showed a natural decline in bacterial counts. Biochemical and colony analyses revealed diverse bacterial species, including Staphylococcus aureus, Micrococcus luteus, Bacillus spp., Aeromonas hydrophila, Enterococcus faecalis, Corynebacterium sp., Vibrio cholerae, and Listeria monocytogenes. Antibiotic susceptibility tests indicated that both Gram-positive and Gram-negative isolates exhibited multidrug resistance, with inhibition zones ranging between 10 mm and 16 mm. Fungal isolates included Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowii, Eurotium sp., and Aspergillus flavus. Molecular assays detected the presence of blaOXA and qnrA resistance genes, while blaNDM, blaTEM, blaSHV, tetA, tetB, and cmlA were not detected. These findings highlight the superior bactericidal effect of chlorine relative to Moringa oleifera and sunlight, Moringa oleifera become an alternative source to chlorine and its effects on multidrug resistant microorganisms in pond water, but also reveal the persistence of multidrug-resistant bacteria and fungi in treated pond water. The study underscores the need for integrated water treatment approaches and continuous monitoring to safeguard aquaculture productivity and public health.

Published in	Journal of Diseases and Medicinal Plants (Volume 12, Issue 2)
DOI	10.11648/j.jdmp.20261202.11
Page(s)	70-87
Creative Commons	This is an Open Access article, distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution and reproduction in any medium or format, provided the original work is properly cited.
Copyright	Copyright © The Author(s), 2026. Published by Science Publishing Group

Keywords

Pond Water Management, Eco-Friendly, Conventional Treatment Strategies

1. Introduction

Water is the most abundant compound on Earth's surface, covering about 70 percent of the planet in nature, and it exists in liquid, solid and gaseous states

[1]

. It is in dynamic equilibrium between the liquid and gas states at standard temperature and pressure at room temperature, it is a tasteless and odorless liquid with a hint of blue

[2]

. Many substances dissolve in water and it is commonly referred to as the universal solvent, because of this, water in nature and in use is rarely pure and some of its properties may vary slightly from those of the pure substances. However, there are also many compounds that are essentially, if not completely insoluble in water, water is the only common substances found naturally in all three (3) common states of matter and it is essential for all life on earth

[3]

. Water usually makes up 55 percent to 78 percent of the human body

[4]

When it comes to purifying water, there are two main approaches, which include natural treatments and chemical treatments

[5]

. Chemical treatments are still the most common method used in the purification of water. Chlorine, for example, is used for disinfection, and alum (aluminum sulfate) for coagulation and flocculation

[6]

. These techniques are well-established due to their rapidity, scalability, and well-defined performance. However, the chemical method has a lot of drawbacks, including the cost, residual chemicals, and potential ecological impacts, which have encouraged the interest in more sustainable alternatives

[7]

. Despite the higher removal and cleaning ability of the chemical alums in the past years, there has been considerable interest in the development of the usage of natural coagulants, which can be produced and extracted from microorganisms, animal, or plant tissues

[8]

. These coagulants should be biodegradable and are presumed to be safe for human health. This has made the comparative study of natural versus chemical treatments an important area of investigation, particularly for small water bodies where affordability, sustainability, and ecological safety are critical considerations

[9]

Biological treatments, which are the most important ones for the purification of civil and industrial wastewater are used to eliminate biodegradable organic substances and compounds that contain nitrogen and in small percentages phosphates, always require a primary treatment to eliminate the substances that are negative for the biological treatment and a subsequent one to remove the substances not removed with the biological treatment. The treatments that accompany the biological treatment are: denitrification, carried out in the absence of O₂, nitrification and oxidation, carried out in the presence of O₂, post-denitrification, carried out in the absence of O₂ and post-aeration carried out in the presence of O₂

[10]

. These treatments are always followed by flocculation, sedimentation/decantation and sludge filtration.

Moringa oleifera (Lam.) is the most widely cultivated species of a monogeneric family, the Moringaceae, that is native to the sub-Himalayan tracts of India, Pakistan, Bangladesh and Afghanistan

[11]

. All parts of the Moringa tree are edible and have long been consumed by humans. According to Traore et al. (2021)

[12]

the many uses for Moringa include: alley cropping (biomass production), animal forage (leaves and treated seed-cake), biogas (from leaves), domestic cleaning agent (crushed leaves), blue dye (wood), fencing (living trees), fertilizer (seed-cake), foliar nutrient (juice expressed from the leaves), green manure (from leaves), gum (from tree trunks), honey- and sugar cane juice-clarifier (powdered seeds), honey (flower nectar), medicine (all plant parts), ornamental plantings, biopesticide (soil incorporation of leaves to prevent seedling damping off), pulp (wood), rope (bark), tannin for tanning hides (bark and gum), water purification (powdered seeds). Moringa oleifera leaf oil (yield 30-40% by weight), also known as Ben oil, is a sweet non-sticking, non-drying oil that resists rancidity. It has been used in salads, for fine machine lubrication, and in the manufacture of perfume and hair care products

[13]

. Moringa oleifera is one of the most valued plants mainly for its tender pods. All its parts bark, root, fruit, flowers, leaves, seeds, and even gum are of medicinal value. They are used in the treatment of different infections/diseases, including cholera, diarrhea, rheumatism, venomous bites, etc

[13]

Download: Download full-size image

Figure 1. Image of Moringa olifera

[14]

2. Materials and Methodology

2.1. Study Area and Sample Collection of Water Samples from AAUA Fishery Pond

Pond water samples were collected from the Adekunle Ajasin University, Akungba-Akoko (AAUA) study site using sterile one-litre amber glass bottles. Each bottle was rinsed three times with pond water at the collection point before the actual sample was taken. Samples were collected at a depth of approximately 20–30 cm below the water surface to avoid debris and surface contamination. Each bottle was labelled with sample identification, date, and time of collection. The samples were immediately transported in an ice-packed cooler to the laboratory for processing within two hours of collection. An untreated control sample was also kept for each batch

[15]

2.2. Preparation of Water Samples from AAUA Fishery Pond

The pond water sample was divided into 1 L portions for treatment. Each treatment was carried out in two replicates. The treatments included chlorine at two concentrations (0.5 mg/L and 1.0 mg/L), Moringa oleifera (Lam) leaf powder at two concentrations (0.5 g/L and 1.0 g/L), and sunlight exposure. An untreated control was maintained alongside. This gave a total of six treatment bottles per batch of pond water

[16]

2.3. Preparation of Moringa Leaf for Treatment of Water Samples from AAUA Fishery Pond

Leafs of Moringa oleifera were collected, air-dried. The leafs were ground into fine powder using a sterile laboratory blender. For treatment, the powdered leafs were measured directly and added into the pond water samples. To obtain a concentration of 0.5 g/L, 0.5 g of the powdered leafs was weighed and added to 1 L of pond water, while 1.0 g of powdered leafs was added to 1 L of pond water to achieve a concentration of 1.0 g/L. Each treated sample was vigorously shaken for about 2–3 minutes to ensure even dispersion of the powder throughout the water, and then allowed to stand under room conditions before microbial analysis

[17]

2.4. Preparation of Chlorine Solutions for Treatment of Water Samples from AAUA Fishery Pond

Commercial household bleach containing approximately 5% available chlorine (50,000 mg/L) was used. A working stock solution was prepared by diluting 1 mL of the bleach into 999 mL of sterile distilled water to obtain 50 mg/L chlorine. From this stock, 10 mL was added to 1 L of pond water to achieve 0.5 mg/L, while 20 mL was added to 1 L to achieve 1.0 mg/L.

Sunlight Exposure for treatment of Water samples from AAUA Fishery Pond

For sunlight treatment, 1 L of pond water was transferred into sterile, transparent glass bottles and exposed directly to sunlight. The bottles were placed on an open platform where they received uninterrupted solar radiation during the experimental period

[18]

2.5. Treatment of Water Samples from AAUA Fishery Pond

Each treated and control sample was left to stand under room conditions. Microbiological analyses were carried out at 2-hour intervals up to 6 hours (2, 4, and 6 hrs) on the same day. At each interval, aliquots were aseptically withdrawn from each treated bottle and processed for microbial isolation.

2.6. Microbial Isolation and Enumeration of Water Samples from AAUA Fishery Pond

Serial dilution technique was employed. One milliliter of each treated sample was aseptically transferred into 9 mL of sterile water to obtain a 10^-1 dilution, followed by successive dilutions up to 10^-6. Aliquots (1 mL) of dilution 10^-3 and 10^-6were inoculated into sterile Petri dishes. Nutrient Agar (NA), MacConkey Agar, Potato Dextrose Agar (PDA) were used for microbial isolation. The prepared media were poured into the Petri dishes containing the inoculum, mixed thoroughly, and allowed to solidify. Plates for bacteria were incubated at 37°C for 24 hrs, while those for fungi were incubated at 27°C for 72 hrs. Distinct colonies were counted and expressed as colony forming units per milliliter (CFU/mL)

[19]

Sub-culturing and Preservation of isolates of pond water samples from AAUA

Pure isolates were carefully transferred onto freshly prepared nutrient agar and PDA slants contained in sterile McCartney bottles to ensure the maintenance of their viability and purity. The inoculated slants were incubated at 37°C for 24 hours to allow adequate growth of the organisms. After incubation, the cultures were preserved by refrigeration at 4°C and subsequently used for further microbiological analyses

[19]

2.7. Identification of Microorganisms from Water Samples from AAUA Fishery Pond

Identification of water sample from the ponds were performed using both the conventional and molecular methods of identification and characterization of sample

[15, 20-23]

2.8. Identification of Fungal Isolates from Water Samples from AAUA Fishery Pond

Fungal isolates were identified through examination of their cultural and morphological features such as colony appearance, growth pattern, pigmentation, and conidial structures. The procedure described by Martínez-Gallardo et al. (2021)

[22]

was followed, employing a staining method to facilitate observation. A drop of lactophenol cotton blue stain was placed on a clean glass slide, after which a small portion of aerial mycelium from representative fungal cultures was carefully transferred into the stain using a sterile mounting needle. The mycelium was evenly spread on the slide, and a coverslip was gently placed over it with slight pressure to eliminate air bubbles. The prepared slides were then examined under a light microscope using ×10 and ×40 objective lenses, and the distinct morphological features of the fungal isolates were carefully observed, recorded, and used for identification.

2.9. Molecular Analysis of Bacterial Isolates and MDR-coding Gene

Bacteria DNA extraction

DNA was extracted using the protocol stated by (1). Briefly, Single colonies grown on medium were transferred to 1.5 ml of liquid medium and cultures were grown on a shaker for 48 h at 28°C. After this period, cultures were centrifuged at 4600g for 5 min. The resulting pellets were resuspended in 520 μl of TE buffer (10 mMTris-HCl, 1mM EDTA, pH 8.0). Fifteen microliters of 20% SDS and 3 μl of Proteinase K (20 mg/ml) were then added. The mixture was incubated for 1 hour at 37°C, then 100 μl of 5 M NaCl and 80 μL of a 10% CTAB solution in 0.7 M NaCl were added and votexed. The suspension was incubated for 10 min at 65°C and kept on ice for 15 min. An equal volume of chloroform: isoamyl alcohol (24:1) was added, followed by incubation on ice for 5 min and centrifugation at 7200g for 20 min. The aqueous phase was then transferred to a new tube and isopropanol (1: 0.6) was added and DNA precipitated at –20°C for 16 h. DNA was collected by centrifugation at 13000g for 10 min, washed with 500 μl of 70% ethanol, air-dried at room temperature for approximately three hours and finally dissolved in 50 μl of TE buffer.

MDR-coding Genes

Molecular investigations of MDR-coding genes in the resistant isolates were by simple PCR on the extracted DNA using gene coding regions specific primers. Primer sequences were as earlier documented. Reaction cocktail used for all PCR per primer set included (Reagent Volume µl) - 5X PCR SYBR green buffer (2.5), MgCl2 (0.75), 10pM DNTP (0.25), 10pM of each forward and backwards primer (0.25), 8000U of taq DNA polymerase (0.06) and made up to 10.5 with sterile distilled water to which 2 µl template was added. Buffer control was also added to eliminate any probability of false amplification. Table 1 below shows the primer sequence and PCR profile used in amplifying each fragment. PCR was carried out in a GeneAmp 9700 PCR System Thermalcycler (Applied Biosystem Inc., USA) using the appropriate profile as designed for each primer pair.

Table 1. Primer sequence and Polymerase Chain Reaction (PCR) profile.

Multiplex	Gene	Primer	Primer sequence 5’-3’	Profile
Multiplex1	bla OXA	OXA R	TTCTGTTGTTTGGGTTTCGC	An initial denaturing 5min at 94°C, then 35 cycles of 94°C for 30s, 50°C for 40s 72°C for 30s and terminate at 72°C for 10min
		OXA R	ACGCAGGAATTGAATTTGTT
	bla NDM	NDM F	GGTGTTTGGTCGCATATCGCAA
		NDM R	ATTCAGCCAGATCGGCATCGGC
Multiplex2	blaTem	Tem F	GTCGCCGCATACACTATTCTCA	An initial denaturing 5min at 94°C, then 35 cycles of 94°C for 30s, 49°C for 40s 72°C for 35s and terminate at 72°C for 10min
		Tem R	CGCTCGTCGTTTGGTATGG
	bla SHV	SHV F	GCCTTGACCGCTGGGAAAC
		SHV R	GGCGTATCCCGCAGATAAAT
	qnrA	qnrAF	ATTTCTCACGCCAGGATTTG	An initial denaturing 5min at 94°C, then 35 cycles of 94°C for 30s, 50°C for 30s 72°C for 30s and terminate at 72°C for 10min
		qnrAR	GATCGGCAAAGGTTAGGTCA
	qnrS	qnrSF	ACGACATTCGTCAACTGCAA
		qnrSR	TAAATTGGCACCCTGTAGGC
	tetA	tetAF	GGCGGTCTTCTTCTTCATCATGC	An initial denaturing 5min at 94°C, then 35 cycles of 94°C for 30s, 49°C for 40s 72°C for 35s and terminate at 72°C for 10min
		tetAR	CGGCAGGCAGAGCAAGTAGA
	tetB	tetBF	CCTCAGCTTCTCAACGCGTG
		tetBR	GCACCTTGCTCATGACTCTT
	cmlA	cmlA-F	CCGCCACGGTGTTGTTGTTATC	An initial denaturing 5min at 94°C, then 35 cycles of 94°C for 30s, 52°C for 30s 72°C for 40s and terminate at 72°C for 10min
		cmlA-R	CACCTTGCCTGCCCATCATTAG

2.10. Gel Electrophoresis

The integrity of the amplified gene fragment was checked on a 1% Agarose gel ran to confirm amplification. The buffer (1XTAE buffer) was prepared and subsequently used to prepare 1.5% agarose gel. The suspension was boiled in a microwave for 5 minutes. The molten agarose was allowed to cool to 60°C and stained with 3µl of 0.5 g/ml ethidium bromide (which absorbs invisible UV light and transmits the energy as visible orange light). A comb was inserted into the slots of the casting tray and the molten agarose was poured into the tray. The gel was allowed to solidify for 20 minutes to form the wells. The 1XTAE buffer was poured into the gel tank to barely submerge the gel. Two microliter (2 l) of 10X blue gel loading dye (which gives colour and density to the samples to make it easy to load into the wells and monitor the progress of the gel) was added to 4µl of each PCR product and loaded into the wells after the 100bp DNA ladder was loaded into well 1. The gel was electrophoresed at 120V for 45 minutes visualized by ultraviolet trans-illumination and photographed. The sizes of the PCR products were estimated by comparison with the mobility of a 100bp molecular weight ladder that was ran alongside experimental samples in the gel.

3. Results

Table 2. Effect of Moringa oleifera (0.5g) on bacteria load from water samples from AAUA Fishery Pond.

Time	CFU/ml (10^-3)	CFU/ml (10^-6)
0 hr	3.5×10⁴	2.0×10⁷
2 hr	2.6×10⁴	1.5×10⁷
4 hr	1.6×10⁴	1.1×10⁷
6 hr	7.0×10³	6.0×10⁶

Table 2: Shows that treatment with 0.5g of Moringa caused a gradual reduction in bacterial counts over time. At the 10^-3 dilution, the counts declined from 3.5×10⁴ CFU/mL at 0hr to 7.0×10³ CFU/mL at 6 hr. Similarly, at the 10^-6 dilution, the counts decreased from 2.0×10⁷ CFU/mL to 6.0×10⁶ CFU/mL within the same period. This indicates that 0.5g of Moringa had a moderate antibacterial effect.

Table 3. Effect of Moringa oleifera (1 g) on bacteria load from water samples from AAUA Fishery Pond.

Time	CFU/ml (10^-3)	CFU/ml (10^-6)
0 hr	2.0×10⁴	1.0×10⁷
2 hr	2.0×10⁴	8.0×10⁶
4 hr	2.0×10⁴	7.0×10⁶
6 hr	2.0×10⁴	5.0×10⁶

Keys: Hr = Hours, Cfu/ml = Colony forming unit per millimeter, g = gram

Table 3: Reveals that treatment with 1g of Moringa did not produce significant bacterial reduction at the 10^-3 dilution, as the count remained constant at 2.0×10⁴ CFU/mL throughout the 6-hour period. However, at the 10^-6 dilution, the bacterial load reduced slightly from 1.0×10⁷ CFU/mL at 0 hr to 5.0×10⁶ CFU/mL at 6 hr. This suggests that 1g of Moringa exerted only a mild inhibitory effect.

Table 4. Effect of Sunlight exposure on bacteria load from water samples from AAUA Fishery Pond.

Time	CFU/ml (10^-3)	CFU/ml (10^-6)
0 hr	6.0×10⁴	3.5×10⁷
2 hr	4.2×10⁴	2.5×10⁷
4 hr	2.5×10⁴	1.4×10⁷
6 hr	7.0×10³	4.0×10⁶

Keys: Hr = Hours, Cfu/ml = Colony forming unit per millimeter, g = gram

Table 4: Shows the effect of sunlight exposure on bacterial counts. At the 10^-3 dilution, bacterial load declined from 6.0×10⁴ CFU/mL at 0 hr to 7.0×10³ CFU/mL at 6 hr. Likewise, at the 10^-6 dilution, counts dropped from 3.5×10⁷ CFU/mL at 0 hr to 4.0×10⁶ CFU/mL at 6 hr. This indicates that sunlight exposure progressively reduced bacterial load over time.

Table 5. Effect of Chlorine (0.5 g) on bacteria load from Water samples from AAUA Fishery Pond.

Time	CFU/ml (10^-3)	CFU/ml (10^-6)
0 hr	6.5×10⁴	4.0×10⁷
2 hr	4.3×10⁴	2.7×10⁷
4 hr	2.2×10⁴	1.3×10⁷
6 hr	0	0

Keys: Hr = Hours, Cfu/ml = Colony forming unit per millimeter, g = gram

Table 5: Shows that 0.5 g of chlorine significantly reduced bacterial counts. At the 10^-3 dilution, the counts dropped from 6.5×10⁴ CFU/mL at 0 hr to 0 CFU/mL by the 6th hour. A similar effect was observed at the 10^-6 dilution, where counts decreased from 4.0×10⁷ CFU/mL to 0 CFU/mL within 6 hours. This demonstrates a strong bactericidal effect of 0.5 g chlorine.

Table 6. Effect of Chlorine (1g) on bacteria load from water samples from AAUA Fishery Pond.

Time	CFU/ml (10^-3)	CFU/ml (10^-6)
0 hr	1.0×10⁴	1.0×10⁶
2 hr	7.0×10³	1.0×10⁶
4 hr	3.0×10³	0
6 hr	0	0

Keys: Hr = Hours, Cfu/ml = Colony forming unit per millimeter, g = gram

Table 6: indicates that 1g of chlorine produced the most rapid antibacterial effect. At the 10^-3 dilution, the bacterial count reduced from 1.0×10⁴ CFU/mL at 0 hr to 0 CFU/mL by the 6th hour. At the 10^-6 dilution, growth was completely eliminated from the 4th hour onward. This confirms that 1 g of chlorine was the most effective treatment.

Table 7. Bacteria load from Water samples from AAUA Fishery Pond without treatment.

Time	CFU/ml (10^-3)	CFU/ml (10^-6)
0 hr	8.2×10⁴	6.0×10⁷
2 hr	5.8×10⁴	4.2×10⁷
4 hr	3.4×10⁴	2.5×10⁷
6 hr	1.0×10⁴	7.0×10⁶

Keys: Hr = Hours, Cfu/ml = Colony forming unit per millimeter

Table 7: presents the untreated control. At the 10^-3 dilution, bacterial counts decreased from 8.2×10⁴ CFU/mL at 0 hr to 1.0×10⁴ CFU/mL at 6 hr. At the 10^-6 dilution, the load declined from 6.0×10⁷ CFU/mL at 0 hr to 7.0×10⁶ CFU/mL after 6 hours. This shows only a natural reduction in bacterial counts without any treatment.

Table 8. Cultural characteristics of Bacterial isolates on agar from water samples from AAUA Fishery Pond.

Code	Color on Agar	Elevation	Opacity
MDC3	Creamy/Whitish	Raised	Opaque
SDC2	White/Dull	Flat/Raised	Opaque
SDC4	White/Dull	Flat/Raised	Opaque
CDCI	White/Dull	Flat/Raised	Opaque
MDC5	Greenish/Gray	Raised	Translucent
CHDCI	Golden Yellow	Convex	Opaque
MDC2	Creamy/White	Raised	Opaque
MDC7	White/Dull	Flat/Raised	Opaque
CHDC3	Grayish/White	Raised	Opaque
SDC3	Grayish/White	Raised	Opaque
MDC4	Golden Yellow	Convex	Opaque
MDCI	Bright Yellow	Convex	Opaque
CHDC2	Grayish-Blue	Low convex	Translucent
CODCI	Creamy/Whitish	Raised	Opaque
MSDCI	Greenish/Gray	Raised	Translucent
MSDC3	Yellowish	Flat	Translucent
MSDC2	Grayish/White	Raised	Opaque
MCODCI	Grayish/White	Raised	Opaque
MMDC2	White/Dull	Flat/Raised	Opaque
MMDC6	Greenish/Gray	Raised	Translucent
MSDCL	White/Cream	Low convex	Opaque
MMDCI	Golden Yellow	Convex	Opaque
MCHDC1	Creamy/Whitish	Raised	Opaque
MMDC5	White/Dull	Flat/Raised	Opaque
MMDC4	Creamy/Whitish	Raised	Opaque
MMDC3	Greenish/Gray	Raised	Translucent
MCDCI	Yellow/Orange	Convex	Opaque
MCHDC2	Golden Yellow	Convex	Opaque

Table 8: represents the colony morphology of bacterial isolates observed on agar, with each isolate code associated with its specific color, elevation, and opacity. The colony colors varied widely, ranging from creamy or whitish, white and dull, grayish white, greenish gray, golden yellow, bright yellow, yellow to orange, and grayish blue. In terms of elevation, the colonies were recorded as flat, raised, convex, or low convex. Most of the colonies appeared opaque, while a few showed translucency.

Table 9. Biochemical Characteristics of Bacteria Isolated from Moringa oleifera -Treated Water samples from AAUA Fishery Pond.

Isolate Code	Shape	Gram	Oxidase	Coagulase	Catalase	Citrate	MR	Indole	Motility	Urease	Lactose	Galactose	Mannitol	Sucrose	Glucose	Dextrose
MDC1	Cocci	+	–	–	+	–	–	–	–	–	–	–	–	–	+	–
MDC2	Rod	+	–	–	+	+	+	–	+	–	–	–	+	–	+	++
MDC3	Rod	+	–	–	+	+	+	–	+	–	+	–	++	–	+++	–
MDC4	Cocci	+	–	+	+	–	–	–	–	–	+	–	++	–	+++	–
MDC5	Rod	–	+	–	+	+	–	+	–	–	–	++	–	+++	+	–
MDC7	Rod	+	–	–	+	+	+	–	+	–	–	++	–	+++	–	–
MMDC1	Cocci	+	–	+	+	–	–	–	–	–	+	–	++	–	+++	–
MMDC2	Rod	+	–	–	+	+	+	–	+	–	+	–	++	–	+++	–
MMDC3	Rod	–	+	–	+	+	+	–	+	–	++	–	+++	+	+++	–
MMDC4	Rod	+	–	–	+	+	+	–	+	–	++	–	–	++	–	–
MMDC5	Rod	+	–	–	+	+	+	–	+	–	+	–	++	–	+++	–
MMDC6	Rod	–	+	–	+	+	+	–	+	–	++	–	+++	+	+++	–

Keys: + = Positive, - = Negative, A = Acid, G = Gas

Table 10. Bacterial Species Isolated from Moringa oleifera -Treated Water samples from AAUA Fishery Pond.

Isolate Code	Probable organism
MDC1	Micrococcus luteus
MDC2	Bacillus megaterium
MDC3	Bacillus subtilis
MDC4	Staphylococcus aureus
MDC5	Aeromonas hydrophila
MDC7	Bacillus cereus
MMDC1	Staphylococcus aureus
MMDC2	Bacillus cereus
MMDC3	Aeromonas hydrophila
MMDC4	Bacillus subtilis
MMDC5	Bacillus cereus
MMDC6	Aeromonas hydrophila

Tables 9 and 10: show the biochemical characteristics and species identification of bacteria isolated from Moringa-treated water samples from AAUA Fishery Pond. The Moringa-treated samples demonstrated the highest bacterial diversity. Gram-positive cocci identified included Staphylococcus aureus (MDC4, MMDC1) and Micrococcus luteus (MDC1). Gram-positive rods were dominated by Bacillus species: Bacillus megaterium (MDC2), Bacillus subtilis (MDC3, MMDC4), and Bacillus cereus (MDC7, MMDC2, MMDC5). The Gram-negative isolates were Aeromonas hydrophila (MDC5, MMDC3, MMDC6). Biochemical tests indicated that all cocci were catalase-positive, with Staphylococcus aureus also coagulase-positive. Bacillus species were catalase-positive, motile, and exhibited variable utilization of citrate, lactose, and sugars such as mannitol, sucrose, glucose, and dextrose. Aeromonas hydrophila isolates were oxidase-positive, motile, and fermented selected sugars, consistent with their Gram-negative classification.

Table 11. Biochemical Characteristics of Bacteria Isolated from Sunlight exposed Water samples from AAUA Fishery Pond.

Isolate Code	Shape	Gram	Oxidase	Coagulase	Catalase	Citrate	MR	Indole	Motility	Urease	Lactose	Galactose	Mannitol	Sucrose	Glucose	Dextrose
SUCI	Rod	–	+	–	+	+	+	–	+	–	–	++	–	+++	+	+++
SDC2	Rod	+	–	–	+	+	+	–	+	–	+	–	++	–	+	+++
SDC3	Cocci	+	–	–	+	–	+	–	–	–	+	–	+	–	++	–
SDC4	Rod	+	–	–	+	+	+	–	+	–	+	–	++	–	–	+++
MSDC1	Cocci	+	–	–	+	–	–	–	–	–	+	–	+	–	–	++
MSDC2	Cocci	+	–	–	+	–	–	–	–	–	+	–	+	–	–	++
MSDC3	Rod	–	+	–	+	+	–	+	–	–	++	–	+++	+	+++	–

Keys: + = Positive, - = Negative, A = Acid, G = Gas

Table 12. Bacterial Species Isolated from Sunlight exposed Water samples from AAUA Fishery Pond.

Isolate Code	Probable organism
SDCI	Aeromonas hydrophila
SDC2	Bacillus cereus
SDC3	Enterococcus faecalis
SDC4	Bacillus cereus
MSDC1	Corynebacterium sp.
MSDC2	Enterococcus faecalis
MSDC3	Vibrio cholerae

Tables 11 and 12: present the biochemical characteristics and species identification of bacteria isolated from sunlight exposed water samples from AAUA Fishery Pond. Gram-positive cocci included Enterococcus faecalis (SDC3, MSDC2) and Corynebacterium sp. (MSDC1), while Gram-positive rods were represented by Bacillus cereus (SDC2, SDC4). Gram-negative isolates were limited to Aeromonas hydrophila (SUCI) and Vibrio cholerae (MSDC3). Biochemical differentiation of the isolates was largely based on catalase and coagulase activity in Staphylococcus species, spore formation in Bacillus, and the distinct oxidase positivity and glucose fermentation of Vibrio cholerae. The presence of V. cholerae indicates that waterborne pathogens can persist despite sunlight treatment.

Table 13. Biochemical Characteristics of Bacteria Isolated from Chlorine Treated Water samples from AAUA Fishery Pond.

Isolate Code	Shape	Gram	Oxidase	Coagulase	Catalase	Citrate	MR	Indole	Motility	Urease	Lactose	Galactose	Mannitol	Sucrose	Glucose	Dextrose
CHDC1	Cocci	+	–	+	+	–	–	–	–	–	+	–	++	–	+++	–
CHDC2	Rod	+	–	–	+	+	–	+	–	–	+	–	++	–	+	+++
CHDC3	Cocci	+	–	–	+	–	–	–	–	–	+	–	+	–	–	++
MCHDC1	Rod	+	–	–	+	+	–	+	–	+	–	++	–	++	–	–
MCHDC2	Cocci	+	–	+	+	–	–	–	–	–	+	–	++	–	+++	–

Keys: + = Positive, - = Negative, A = Acid, G = Gas

Table 14. Bacterial Species Isolated from Chlorine Treated Water samples from AAUA Fishery Pond.

Isolate Code	Species
CHDC1	Staphylococcus aureus
CHDC2	Listeria monocytogenes
CHDC3	Enterococcus faecalis
MCHDC1	Bacillus subtilis
MCHDC2	Staphylococcus aureus

Tables 13 and 14: Show the biochemical characteristics and species identification of bacteria isolated from chlorine-treated and control water samples from AAUA Fishery Pond. Overall, these samples yielded fewer isolates, suggesting that chlorine treatment partially reduced microbial diversity. Gram-positive cocci included Staphylococcus aureus (CHDC1, MCHDC2) and Enterococcus faecalis (CHDC3), while Gram-positive rods were represented by Listeria monocytogenes (CHDC2) and Bacillus subtilis (MCHDC1). The Gram-negative fraction was minimal compared with Moringa- and sunlight-treated samples. Most isolates tested catalase positive, with variation in coagulase activity, indole production, and carbohydrate utilization, supporting their taxonomic classification.

Table 15. Biochemical Characteristics of Bacteria Isolated from Untreated Water samples from AAUA Fishery Pond.

Isolate Code	Shape	Gram	Oxidase	Coagulase	Catalase	Citrate	MR	Indole	Motility	Urease	Lactose	Galactose	Mannitol	Sucrose	Glucose	Dextrose
CDC1	Cocci	+	–	+	+	–	–	–	–	+	–	++	–	+++	–	–
CODCI	Rod	+	–	–	+	+	–	–	–	+	–	++	–	+	+++	–
MCODC1	Cocci	+	–	–	+	–	–	–	–	+	–	+	–	–	–	++
MCDC1	Rod	+	–	+	+	–	–	–	–	–	++	–	++	–	–	–

Table 16. Bacterial Species Isolated from Untreated Treated Water samples from AAUA Fishery Pond.

Isolate Code	Species
CDC1	Bacillus cereus
CODCI	Bacillus subtilis
MCODC1	Enterococcus faecalis
MCDC1	Kocuria kristinae

Tables 15 and 16: Present the biochemical characteristics and species identification of bacteria isolated from untreated water samples from AAUA Fishery Pond. The untreated samples revealed a limited diversity of isolates. Gram-positive cocci included Enterococcus faecalis (MCODC1) and Kocuria kristinae (MCDC1), while Gram-positive rods were represented by Bacillus cereus (CDC1) and Bacillus subtilis (CODCI). Biochemical testing showed that most isolates were catalase positive, with variation in coagulase activity, motility, and carbohydrate utilization, consistent with their respective taxonomic identities

Table 17. Antibiotic susceptibility profile of Gram negative bacteria isolated from Water samples from AAUA Fishery Pond.

Isolate	GEN	CPX	LEV	AZM	AMX	CHL	SPX	AUG	PRN	OFL
Aeromonas hydrophila	12 (I)	15 (I)	10 (R)	14 (I)	11 (R)	13 (I)	16 (S)	12 (I)	14 (I)	10 (R)
Aeromonas hydrophila	11 (R)	13 (I)	12 (I)	15 (I)	10 (R)	14 (I)	12 (I)	13 (I)	15 (I)	11 (R)
Aeromonas hydrophila	13 (I)	14 (I)	11 (R)	12 (I)	13 (I)	15 (I)	10 (R)	14 (I)	11 (R)	12 (I)
Aeromonas hydrophila	10 (R)	12 (I)	14 (I)	13 (I)	12 (I)	11 (R)	15 (I)	10 (R)	13 (I)	14 (I)
Vibrio cholerae	15 (I)	10 (R)	13 (I)	11 (R)	14 (I)	12 (I)	13 (I)	15 (I)	12 (I)	11 (R)

Key: GEN = Gentamicin, CPX = Ciprofloxacin, LEV = Levofloxacin, AZM = Azithromycin, AMX = Amoxicillin, CHL = Chloramphenicol, SPX = Sparfloxacin, AUG = Augmentin, PRN = Pefloxacin, and OFL = Ofloxacin, R = Resistance, I = Intermediate

Table 17: presents the antibiotic susceptibility profile of Gram-negative bacteria isolated from pond water, including four isolates of Aeromonas hydrophila and one isolate of Vibrio cholerae. The measured zones of inhibition ranged from 10 mm to 16 mm across the antibiotics tested (Gentamicin, Ciprofloxacin, Levofloxacin, Azithromycin, Amoxicillin, Chloramphenicol, Sparfloxacin, Augmentin, Pefloxacin, and Ofloxacin). Although there was slight variation in the zone diameters between isolates, all isolates fell below the susceptibility breakpoint, indicating complete resistance.

Table 18. Antibiotic susceptibility profile of Gram positive bacteria isolated from Water samples from AAUA Fishery Pond.

Isolate	GEN	CPX	LEV	AZM	CAZ	AMX	APX	PRN	RIF	ERY
Micrococcus luteus	12 (I)	15 (I)	10 (R)	14 (I)	13 (I)	11 (R)	12 (I)	14 (I)	10 (R)	13 (I)
Bacillus megaterium	11 (R)	12 (I)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)	11 (R)	12 (I)	15 (I)
Bacillus subtilis	14 (I)	11 (R)	12 (I)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)	13 (I)	11 (R)
Staphylococcus aureus	10 (R)	13 (I)	14 (I)	12 (I)	11 (R)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)
Bacillus cereus	13 (I)	12 (I)	15 (I)	11 (R)	10 (R)	14 (I)	12 (I)	13 (I)	11 (R)	12 (I)
Bacillus subtilis	12 (I)	14 (I)	11 (R)	13 (I)	12 (I)	15 (I)	10 (R)	14 (I)	13 (I)	11 (R)
Staphylococcus aureus	15 (I)	12 (I)	10 (R)	14 (I)	13 (I)	12 (I)	11 (R)	15 (I)	10 (R)	13 (I)
Enterococcus faecalis	11 (R)	13 (I)	12 (I)	15 (I)	14 (I)	12 (I)	13 (I)	11 (R)	15 (I)	10 (R)
Kocuria kristinae	12 (I)	15 (I)	11 (R)	13 (I)	12 (I)	14 (I)	10 (R)	12 (I)	13 (I)	11 (R)
Staphylococcus aureus	13 (I)	10 (R)	14 (I)	12 (I)	11 (R)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)
Bacillus cereus	12 (I)	14 (I)	11 (R)	13 (I)	12 (I)	15 (I)	10 (R)	14 (I)	13 (I)	11 (R)
Bacillus subtilis	14 (I)	11 (R)	12 (I)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)	13 (I)	11 (R)
Bacillus cereus	10 (R)	13 (I)	12 (I)	14 (I)	11 (R)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)
Corynebacterium sp.	13 (I)	12 (I)	15 (I)	11 (R)	10 (R)	14 (I)	12 (I)	13 (I)	11 (R)	12 (I)
Bacillus cereus	12 (I)	14 (I)	11 (R)	13 (I)	12 (I)	15 (I)	10 (R)	14 (I)	13 (I)	11 (R)
Enterococcus faecalis	15 (I)	12 (I)	10 (R)	14 (I)	13 (I)	12 (I)	11 (R)	15 (I)	10 (R)	13 (I)
Bacillus cereus	11 (R)	13 (I)	12 (I)	15 (I)	14 (I)	12 (I)	13 (I)	11 (R)	15 (I)	10 (R)
Enterococcus faecalis	12 (I)	15 (I)	11 (R)	13 (I)	12 (I)	14 (I)	10 (R)	12 (I)	13 (I)	11 (R)
Staphylococcus aureus	13 (I)	10 (R)	14 (I)	12 (I)	11 (R)	13 (I)	15 (I)	12 (I)	14 (I)	10 (R)
Listeria monocytogenes	12 (I)	14 (I)	11 (R)	13 (I)	12 (I)	15 (I)	10 (R)	14 (I)	13 (I)	11 (R)
Enterococcus faecalis	14 (I)	11 (R)	12 (I)	13 (I)	15 (I)	12 (I)	15 (I)	10 (R)	14 (I)	13 (I)

Keys: GEN = Gentamicin, CPX = Ciprofloxacin, LEV = Levofloxacin, AZM = Azithromycin, CAZ = Ceftazidime, AMX = Amoxicillin, APX = Ampicillin, PRN = Pefloxacin, RIF = Rifampicin, and ERY = Erythromycin, R = Resistance

Table 18: summarizes the antibiotic susceptibility of Gram-positive bacteria from pond water samples. Species tested included Micrococcus luteus, Bacillus megaterium, Bacillus subtilis, Staphylococcus aureus, Bacillus cereus, Enterococcus faecalis, Kocuria kristinae, Corynebacterium sp., and Listeria monocytogenes. The zones of inhibition ranged between 10 mm and 15 mm for the antibiotics tested (Gentamicin, Ciprofloxacin, Levofloxacin, Azithromycin, Ceftazidime, Amoxicillin, Ampicillin, Pefloxacin, Rifampicin, and Erythromycin). Despite minor differences in zone diameters, all isolates demonstrated resistance to all antibiotics tested, confirming a multidrug-resistant profile among Gram-positive bacteria.

Table 19: shows the cultural and morphological characteristics of fungal isolates recovered from treated pond water samples. Colonies varied in color (ranging from blue-green, cinnamon-brown, yellow-green, to yellow-olive), forms (velvety, powdery, cottony, or granular), elevations (flat to raised), hypha type (all septate), and edges (entire, irregular, or lobate).

Table 19. Morphological characteristics of fungal isolates from treated Water samples from AAUA Fishery Pond.

Treatment	Day	Color	Form	Elevation	Hypha Type	Edges
Moringa oleifera (1g)	Day 1	Blue-green to gray	Circular, velvety	Flat to raised	Septate	Entire
	Day 2	Cinnamon-brown	Circular, powdery	Raised	Septate	Entire/regular
Sunlight	Day 1	Greenish-blue	Circular, velvety	Flat	Septate	Entire
	Day 2	Yellow-green	Circular, cottony	Raised	Septate	Irregular
Control	Day 1	Yellow to olive	Circular, granular	Flat	Septate	Entire
	Day 2	Yellow-green	Circular, powdery	Flat to raised	Septate	Lobate/irregular

Download: Download full-size image

Figure 2. Antibiotic susceptibility profile of Gram positive bacteria isolated against Moriga Olefera Water samples from AAUA Fishery Pond.

Table 20. Fungal isolates from treated Water samples from AAUA Fishery Pond.

Treatment	Probable isolates
	Day1	Day 2
Moringa 1g	Aspergillus fumigatus	Aspergillus terries (Thom)
Sunlight	Aspergillus sydowi	Aspergillus devatus
Control	Eurotum spp	Aspergillus flavus

Table 20: aligns these cultural traits with their probable fungal identities. Aspergillus fumigatus and Aspergillus terreus were associated with the moringa treatment, Aspergillus sydowii and Aspergillus devatus with the sunlight treatment, while the control yielded Eurotium spp. and Aspergillus flavus.

Download: Download full-size image

Figure 3. Micrograph of Aspergillus fumigatus.

Download: Download full-size image

Figure 4. Micrograph of Aspergillus terries (Thom).

Download: Download full-size image

Figure 5. Micrograph of Aspergillus sydowi.

Download: Download full-size image

Figure 6. Micrograph of Aspergillus devatus.

Download: Download full-size image

Figure 7. Micrograph of Aspergillus flavus.

Download: Download full-size image

Figure 8. Micrograph of Eurotum spp.

Download: Download full-size image

Figure 9. Shows the gel electrophoresis.

Lane 2 shows a positive result for the blaOXA gene Agarose gel electro phoresis of the PCR products of ESBL NDM and OXA gene amplified from selected bacteria isolates. (Band size approximately 624bp and 190bp indicating NDM and OXA respectively.

Figure 9: The distinct band visible in Lane 2 is at the same position as the 190 bp marker indicated on the ladder (Mk). This signifies that the Polymerase Chain Reaction (PCR) successfully amplified a DNA fragment of approximately 190 base pairs, which corresponds to the expected size of the blaOXA gene using the primers and conditions described in your methodology. No band is visible in this lane at the 624 bp position, indicating the blaNDM gene was not detected in this isolate under the conditions of the experiment.

Figure 10: Gel electrophoresis in Figure 2 shows that the distinct band visible in Lane 3 signifies a positive result for the qnrA gene. The position of this band on the gel is consistent with a DNA fragment size of approximately 516 base pairs, as indicated by the markers on the ladder.

Download: Download full-size image

Figure 10. Agarose gel electrophoresis of the PCR products of qnrA and qnrB genes amplified from selected bacteria isolates. (Band size approximately 516bp and 469bp indicating qnrA and qnrB respectively).

Download: Download full-size image

Figure 11. Agarose gel electrophoresis of the PCR products of ESBL TEM and SHV gene amplified from selected bacteria isolates. (Band size approximately 258bp and 318bp indicating TEM and SHV respectively).

Agarose gel electrophoresis of the PCR products of tetA and tetB gene amplified from selected bacteria isolates. (Band size approximately 500bp and 640bp indicating tetA and tetB respectively).

Lane 2 shows no visible bands. This indicates a negative result, meaning that neither the blaTem gene nor the blaSHV gene was successfully amplified or detected in the sample loaded in that lane.

Download: Download full-size image

Figure 12. Agarose gel electrophoresis of the PCR products of tetA and tetB gene amplified from selected bacteria isolates. (Band size approximately 500bp and 640bp indicating tetA and tetB respectively).

Lane 2 shows no visible bands. This indicates a negative result, meaning that the tetA gene was not detected in the sample loaded in that lane.

Download: Download full-size image

Figure 13. Agarose gel electrophoresis of the PCR products of clmA genes amplified from selected bacteria isolates. (Band size approximately 700bp).

Lane 2 shows no visible bands. This indicates a negative result, meaning the clmA gene was not detected in the sample loaded in that lane.

4. Discussion

Sustainable water management in aquaculture has shifted from conventional flow-through systems, which rely on high water exchange, to eco-friendly closed-loop strategies like Recirculating Aquaculture Systems (RAS) and Integrated Multi-Trophic Aquaculture (IMTA). While conventional methods are simpler and cheaper to implement, they are increasingly criticized for their heavy freshwater reliance and the discharge of untreated, nutrient-rich wastewater that causes eutrophication and habitat destruction. The comparative analysis of natural and chemical treatment methods on pond water samples from AAUA Fishery revealed distinct differences in antibacterial efficacy, microbial diversity, antibiotic resistance, fungal occurrence, and molecular resistance gene detection.

The results of this study revealed that Treatment with 0.5 g of Moringa oleifera produced a moderate reduction in bacterial counts, with declines from 3.5 × 10⁴ to 7.0 × 10³ CFU/mL at 10^-3 dilution and from 2.0 × 10⁷ to 6.0 × 10⁶ CFU/mL at 10^-6 dilution over six hours. Surprisingly, a higher dose of 1 g Moringa was less effective, as counts at 10^-3 dilution remained unchanged and only a slight reduction was observed at 10^-6 dilution. This confirms earlier reports that Moringa’s activity is not strictly dose-dependent due to variability in its active compounds

[24]

. Sunlight treatment performed better, reducing bacterial load steadily from 6.0 × 10⁴ to 7.0 × 10³ CFU/mL at 10^-3 dilution and from 3.5 × 10⁷ to 4.0 × 10⁶ CFU/mL at 10^-6 dilution within six hours, likely due to the combined effects of UV radiation and heat stress on bacterial membranes

[25]

. Chlorine was the most potent disinfectant. At 0.5 g, bacterial counts dropped from 6.5 × 10⁴ CFU/mL to complete elimination by the 6th hour, while 4.0 × 10⁷ CFU/mL at 10^-6 dilution was eradicated within the same period. At 1 g, the effect was faster, with total bacterial clearance achieved as early as the 4th hour. These results affirm chlorine’s broad-spectrum and rapid bactericidal activity via oxidative protein damage

[21]

. By contrast, the untreated control showed only a gradual natural decline, with counts reducing from 8.2 × 10⁴ to 1.0 × 10⁴ CFU/mL at 10^-3 dilution and from 6.0 × 10⁷ to 7.0 × 10⁶ CFU/mL at 10^-6 dilution, a reflection of natural die-off and nutrient depletion

[22]

In this study Moringa-treated samples showed the highest bacterial diversity, including Staphylococcus aureus, Micrococcus luteus, Bacillus megaterium, Bacillus subtilis, Bacillus cereus, and Aeromonas hydrophila. These organisms are consistent with prior reports of Bacillus dominance in aquatic systems due to their spore-forming ability

[26]

. The presence of Aeromonas hydrophila is significant, as it is a known fish pathogen

[21]

. Sunlight-exposed samples yielded Enterococcus faecalis, Corynebacterium sp., Bacillus cereus, Aeromonas hydrophila, and notably Vibrio cholerae. The survival of V. cholerae despite sunlight treatment underscores the limitations of solar exposure, echoing Osuntokun, 2024)

[27]

, who reported persistence of Vibrio species in sunlit waters. Chlorine-treated samples showed fewer isolates, mainly Staphylococcus aureus, Enterococcus faecalis, Listeria monocytogenes, and Bacillus subtilis. This reduced diversity reflects chlorine’s bactericidal action, consistent with Patel and Rawat (2021)

[28]

. In contrast, untreated samples displayed limited diversity, dominated by Enterococcus faecalis, Kocuria kristinae, Bacillus cereus, and Bacillus subtilis. This natural microbiota composition is typical of pond environments

[29]

The antibiotic susceptibility profiles revealed alarming resistance patterns. Gram-negative isolates (Aeromonas hydrophila, Vibrio cholerae) exhibited inhibition zones ranging from 10–16 mm, all below susceptibility breakpoints, indicating complete resistance. Similarly, Gram-positive isolates including Micrococcus luteus, Bacillus spp., Staphylococcus aureus, Enterococcus faecalis, Kocuria kristinae, Corynebacterium sp., Listeria monocytogenes) showed 10–15 mm zones across tested antibiotics, also reflecting multidrug resistance. These findings are consistent with Rai et al. (2022)

[30]

, who noted increasing antimicrobial resistance in aquaculture environments due to selective pressure from agricultural and domestic effluents. Fungal isolates recovered from this study include Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowii, and Aspergillus devatus. Control samples yielded Eurotium spp. and Aspergillus flavus. The dominance of Aspergillus species is expected, given their adaptability to aquatic habitats

[31]

. The persistence of potentially toxigenic A. flavus in untreated samples raises public health concerns, aligning with Sharma et al. (2022)

[32]

, who emphasized fungal contamination risks in aquaculture.

Molecular screening provided insights into genetic resistance determinants. Figure 1 showed amplification of the blaOXA gene (190 bp) in Lane 2, but no detection of blaNDM (624 bp). This confirms the presence of OXA-type beta-lactamase genes conferring resistance to carbapenems, consistent with Li et al. (2023)

[33]

. Figure 2 revealed qnrA (516 bp) in Lane 3, indicating plasmid-mediated quinolone resistance, a finding also reported by Saroj et al. (2022)

[34]

. Isolates showed no amplification of blaTEM, blaSHV, tetA, tetB, or clmA genes, indicating their absence in the screened isolates. This suggests that while resistance genes were present, their distribution was limited, highlighting the need for continuous monitoring. Similar results were reported by Singh et al. (2024)

[35]

, who stressed that resistance gene prevalence varies across aquatic ecosystems depending on anthropogenic influences. The results in this study indicate that chlorine and Moriga olefera was the most effective treatment, achieving complete bacterial elimination within hours, while sunlight and Moringa olefera produced higher moderate reductions. However, Moringa retained higher microbial diversity, which may be beneficial for maintaining ecological balance, though pathogens such as Aeromonas hydrophila and Vibrio cholerae persisted. Antibiotic resistance was widespread across both Gram-negative and Gram-positive isolates, and the detection of blaOXA and qnrA genes confirms genetic drivers of resistance. The fungal diversity highlighted the resilience of Aspergillus species, with implications for aquaculture management. These findings echo global concerns regarding microbial persistence, resistance, and the trade-offs between chemical and natural water treatments

[36]

5. Conclusion

This study demonstrated that pond water from AAUA Fishery harbors a diverse microbial population, including bacteria, fungi, and multidrug-resistant strains carrying resistance genes. Comparative analysis showed that chlorine treatment (0.5 g and 1 g) achieved complete microbial elimination, sunlight treatment reduced but did not eradicate pathogens such as Vibrio cholerae, while Moringa oleifera exhibited moderate antibacterial effects but preserved higher microbial diversity. Colony morphology and biochemical profiling identified multiple Gram-positive and Gram-negative bacteria, while antibiotic susceptibility testing confirmed multidrug resistance. Molecular analysis revealed the presence of blaOXA and qnrA resistance genes, underscoring the genetic basis for antimicrobial resistance in aquatic bacteria. Fungal characterization showed the dominance of Aspergillus species, including toxigenic A. flavus. Overall, chlorine proved most effective, but natural treatments offer eco-friendly alternatives with potential for sustainable aquaculture management.

Abbreviations

AAUA	Adekunle Ajasin University, Akungba-Akoko
MDR	Multi Drug Resistance
CFU/mL	Colony Forming Unit per Millimeter
EDTA	Ethylene Diamine Tetra Acetic Acid
blaOXA	Gene Family That Encodes D β-lactamase Enzymes That Confers Antibiotic Resistance
blaNDM	New Delhi metallo-β-lactamase
blaTEM	Gene in Bacteria That Encodes β-lactamase Enzymes That Confers Antibiotic Resistance
blaSHV	Gene in Bacteria That Encodes β-lactamase Enzymes That Confers Antibiotic Resistance Sulfhydryl Variable
tetA	Gene in Bacteria That Encodes the TetA Protein That Confers Antibiotic, Tetracycline Resistance
tetB	Gene in Bacteria That Confers Resistance to Tetracycline
qnrA	Gene in Bacteria That Confers Resistance to Quinolone, Plasmid-mediated
qnrS	Gene in Bacteria That Confers Resistance to Quinolone
cmlA	Chloramphenicol Resistance gene A

Acknowledgments

The laboratory staff of Adekunle Ajasin University, Department of Microbiology, Faculty of Science, Akungba Akoko, Ondo State, Nigeria.

Author Contributions

Osuntokun Oludare Temitope: Conceptualization, Formal Analysis, Supervision, Validation,Visualization, Writing – original draft

Yusuf-Babatunde Moruf Ademola: Funding acquisition, Project administration, Investigation, Methodology, Resources, Software, Writing – review & editing

Fapohunda Juliet Bisola: Investigation, Methodology, Data curation, Formal Analysis, Resources

Funding

Self-funded research, authorship, and/or publication of this article: Financial assistance was not provided by any Research Foundation.

Conflicts of Interest

The authors have declared that no competing interests exist.

References

[1]	Nath, A., Mishra, A. and Pande, P. P. (2021). A review natural polymeric coagulants in wastewater treatment. Materials Today: Proceedings, 46, 6113-6117, https://doi.org/10.1016/j.matpr.2020.03.551
[2]	Elzagheid Mohamed (2023). Chemical Technicians: Good Laboratory Practice and Laboratory Information Management Systems. https://books.google.com.ng/books?id=BB3TEAAAQBAJ
[3]	Mocek-Płóciniak, A. and Skowrońska, M. (2021). Water-an important element not only of the soil environment. Soil Science Annual, 72(1), 134620, https://doi.org/10.37501/soilsa/134620
[4]	Luvhimbi, N., Tshitangano, T. G., Mabunda, J. T., Olaniyi, F. C. and Edokpayi, J. N. (2022). Water quality assessment and evaluation of human health risk of drinking water from source to point of use at Thulamela municipality, Limpopo Province. Scientific Reports, 12(1), 6059. https://doi.org/10.1038/s41598-022-10092-4
[5]	Charcosset, C. (2022) Classical and recent developments of membrane processes for desalination and natural water treatment. Membranes, 12(3), 267, https://doi.org/10.3390/membranes12030267.
[6]	Tahraoui, H., Toumi, S., Boudoukhani, M., Touzout, N., Sid, A. N. E. H., Amrane, A. and Zhang, J. (2024). Evaluating the effectiveness of coagulation-flocculation treatment using aluminum sulfate on a polluted surface water source: A year-long study. Water, 16(3), 400, https://doi.org/10.3390/w16030400
[7]	Mahjoub, B., Fersi, C., Bouteffeha, M. and Kuemmerer, K. (2025). Green chemistry and sustainable chemistry related to water challenges: Solutions and prospects in a changing climate. Current Opinion in Green and Sustainable Chemistry, 52, 101000 https://doi.org/10.1016/j.cogsc.2025.101000
[8]	Bahrodin, M. B., Zaidi, N. S., Hussein, N., Sillanpää, M., Prasetyo, D. D. and Syafiuddin, A. (2021). Recent advances on coagulation-based treatment of wastewater: Transition from chemical to natural coagulant. Current Pollution Reports, 7(3), 379-391. https://doi.org/10.1007/s40726-021-00191-7
[9]	Badawi, A. K., Salama, R. S. and Mostafa, M. M. M. (2023). Natural-based coagulants/flocculants as sustainable market-valued products for industrial wastewater treatment: a review of recent developments. RSC advances, 13(28), 19335-19355, https://doi.org/10.1039/D3RA01999C
[10]	Wu, L., Wei, W., Xu, J., Chen, X., Liu, Y., Peng, L. and Ni, B. J. (2021). Denitrifying biofilm processes for wastewater treatment: developments and perspectives. Environmental Science: Water Research & Technology, 7(1), 40-67, https://doi.org/10.1039/D0EW00576B
[11]	Islam, S., Ali, M., Banerjee, A., Shah, M. H., Rahman, S. S., Ahammad, F. and Hossain, A. (2023). Moringa oleifera under stressful conditions. In Medicinal Plant Responses to Stressful Conditions (pp. 201-222). CRC Press.
[12]	Traore, R., Zinsou, G. and Balema, K. (2021, March). Promotion of Moringa products via an inclusive value chain for economic, social and environmental impacts in Africa. In IV All Africa Horticultural Congress-AAHC2021: Transformative Innovations in Horticulture 1348 (pp. 247-252), https://doi.org/10.17660/ActaHortic.2022.1348.34
[13]	Jikah, A. N. and Edo, G. I. (2023). Moringa oleifera: a valuable insight into recent advances in medicinal uses and pharmacological activities. Journal of the Science of Food and Agriculture, 103(15), 7343-7361, https://doi.org/10.1002/jsfa.12892
[14]	Al-Jadabi, N., Laaouan, M., El Hajjaji, S., Mabrouki, J., Benbouzid, M. and Dhiba, D. (2023). The dual performance of Moringa oleifera seeds as eco-friendly natural coagulant and as an antimicrobial for wastewater treatment: a review. Sustainability, 15(5), 4280.
[15]	Onajobi, I. B., Samson, O. J., Aina, S. A., Ogunmoye, A. O. and Oyetade, E. O. (2023). Microbiological And Physicochemical Assessments of Selected Fish Pond Water Sample in South-West, Nigeria. Al-Hayat: Journal of Biology and Applied Biology, 6(1), 1-14. https://doi.org/10.21580/ah.v6i1.14166
[16]	Brooks, A. C., Covino, T. and Hall, E. K. (2022). Evaluating Spatial and Temporal Dynamics of River‐Floodplain Surface Water Connectivity Using Hydrometric, Geochemical and Microbial Indicators. Water Resources Research, 58(5), e2021WR030336, https://doi.org/10.1029/2021WR030336
[17]	Dandesa, B., Akuma, D. A. and Alemayehu, E. (2023). Water purification improvement using Moringa oleifera seed extract pastes for coagulation follow scoria filtration. Heliyon, 9(7). https://doi.org/10.1016/j.heliyon.2023.e17420
[18]	Feng, Y., Luo, C., Chen, X., Gu, J., Zhang, Y., Chao, M. and Yan, L. (2022). Shell inspired heterogeneous membrane with smaller bandgap toward sunlight-activated sustainable water purification. Chemical Engineering Journal, 440, 135910. https://doi.org/10.1016/j.cej.2022.135910
[19]	Horn, L., Shakela, N., Mutorwa, M. K., Naomab, E. and Kwaambwa, H. M. (2022). Moringa oleifera as a sustainable climate-smart solution to nutrition, disease prevention, and water treatment challenges: A review. Journal of Agriculture and Food Research, 10, 100397. https://doi.org/10.1016/j.jafr.2022.100397
[20]	Pandey, P. and Khan, F. (2022). Moringa oleifera Plant as potent alternate to Chemical Coagulant in Water Purification. Brazilian Journal of Pharmaceutical Sciences, 58, e201158. https://doi.org/10.1590/s2175-97902022e201158
[21]	Adah, A. D., Saidu, L., Oniye, S. J., Kazeem, H. M. and Adah, S. A. (2021). Prevalence and risk factors associated with Aeromonas hydrophila infection in Clarias gariepinus and pond water from fish farms in Kaduna State, Nigeria. Jordan Journal of Biological Sciences, 14(3), 477-484, https://doi.org/10.54319/jjbs/140313
[22]	Martínez-Gallardo, M. R., López, M. J., López-González, J. A., Jurado, M. M., Suárez-Estrella, F., Pérez-Murcia, M. D. and Moreno, J. (2021). Microbial communities of the olive mill wastewater sludge stored in evaporation ponds: The resource for sustainable bioremediation. Journal of Environmental Management, 279, 111810. https://doi.org/10.1016/j.jenvman.2020.111810 Epub 2020 Dec 17.
[23]	Liu, Z., Xu, D., Pang, B., Wang, S., Wang, S., Gao, Y. and Kong, M. G. (2021). Evaluation of microbial species inactivation and purification of pond sewage by a custom‐built air surface discharge plasma. Plasma Processes and Polymers, 18(6), 2100004, https://doi.org/10.1002/ppap.202100004
[24]	Grinberga, L., Grabuza, D., Grinfelde, I., Lauva, D., Celms, A., Sas, W. and Dzieciol, J. (2021). Analysis of the removal of BOD5, COD and suspended solids in subsurface flow constructed wetland in Latvia. Acta Scientiarum Polonorum. Architectura, 20(4), 21-28, https://doi.org/10.22630/ASPA.2021.20.4.31
[25]	Azuh V. O., Alkhalil S. S., Osuntokun O. T., Oyewole O. A., Jimoh O. T., Maddela N. R. (2026). Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid Detection and Differentiation of Selected Escherichia coli from Other Enterobacteriaceae. Indian J Med Microbiol. 28:101070, ISSN 0255-0857, https://doi.org/10.1016/j.ijmmb.2026.101070
[26]	Prieto, Jacqui, Murphy, Catherine, Stewart, Fiona and Fader, Miranda (2021) Intermittent catheter techniques, strategies and designs for managing long‐term bladder conditions. Cochrane Database of Systematic Reviews, 2021 (10), 1-74, [CD006008]. https://doi.org/10.1002/14651858.CD006008.pub5
[27]	Osuntokun, .O. T (2024). Nicotiana Tabacum Essential Oil Extract from Cigarettes Products against Diverse Smokers Mouth Floral Isolates. Microbiology Archives, an International Journal. Vol 6(1); Pp 30 -39. https://doi.org/10.51470/MA.2024.6.1.30
[28]	Patel H. and Rawat S. (2021). New and future developments in microbial biotechnology and bioengineering, Elsevier 69-93 https://doi.org/10.1016/B978-0-12-821005-5.00005-3
[29]	Oluwakemi Abike Thonda, Fatimah Adenike Ajadi, Olanrewaju Oludotun Daramola, Aderiike Adewumi Grace, Oludare Temitope Osuntokun, Daniel Ayandiran Aina, Temitope Elizabeth Oyewole, Rukevwe Collins Etareri (2025). Preparation and Characterization of Newbouldia laevis (P.Beauv.) Seem. mediated Gold and Alloy Nanoparticles and Evaluation of Its Bactericidal Effect on Clinical Pathogens, Jordan Journal of Biological Science, 18(2), Pp 281 - 290. https://doi.org/10.54319/jjbs/180209
[30]	Rai M., Zimowska B., Kövics G. J. (2022) The Genus Phoma: What We Know and What We Need to Know? In book: Rai M., Zimowska B., Kövics G. J. (eds) Phoma: Diversity, Taxonomy, Bioactivities, and Nanotechnology. (pp. 3-11) Publisher: Springer, Cham: Springer International Publishing.
[31]	Nair Abhinav and Sarma Saurabh Jyoti (2021) The impact of carbon and nitrogen catabolite repression in microorganisms, Review Microbiol Res 2021 Oct: 251: 126831. https://doi.org/10.1016/j.micres.2021.126831
[32]	Sharma D, Denmat SH, Matzke NJ, Hannan K, Hannan RD, O'Sullivan JM, Ganley ARD (2022). A new method for determining ribosomal DNA copy number shows differences between Saccharomyces cerevisiae populations. Genomics 114(4):110430, https://doi.org/10.1016/j.ygeno.2022.110430
[33]	Li J-J, Zhao S-P, Zhao D, Lu G-P, Peng D-Q, Liu J, Chen Z-Y, Guo Y-L, Wu N-Q, Yan S-K, Wang Z-W and Gao R-L (2023) 2023 Chinese guideline for lipid management. Front. Pharmacol. 14:1190934. https://doi.org/10.3389/fphar.2023.1190934
[34]	Saroj, P., P, M. & Narasimhulu, K. (2022). Biochemical Characterization of Thermostable Carboxymethyl Cellulase and β-Glucosidase from Aspergillus fumigatus JCM 10253. Appl Biochem Biotechnol 194, 2503-2527 (2022). https://doi.org/10.1007/s12010-022-03839-2
[35]	Singh G, Sharma K., Sharma L. K., Kumar A. and Parihar K.(2024). FLD (Front Line Demonstration) on the Area Specific Mineral Mixture on the Milk Production of Murrah Buffaloes under Climatic Conditions of Tonk, The Journal of Rural and Agricultural Research Volume 24 No. 2, 51-57.
[36]	Sarwan, J., Sahani, S., Nair, M. V., Bhargav, S., Kumar, S., Singh, R. and Bose, K. J. C. (2024). Multiple factors influencing Theobroma cacao and their impact on the chocolate market worldwide. In Sustainable Cacao Cultivation in Latin America. 256-269, Routledge. https://doi.org/10.4324/9781003381761

Cite This Article

Plain Text BibTeX RIS

APA Style

Temitope, O. O., Ademola, Y. M., Bisola, F. J. (2026). Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm). Journal of Diseases and Medicinal Plants, 12(2), 70-87. https://doi.org/10.11648/j.jdmp.20261202.11

Copy | Download

ACS Style

Temitope, O. O.; Ademola, Y. M.; Bisola, F. J. Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm). J. Dis. Med. Plants 2026, 12(2), 70-87. doi: 10.11648/j.jdmp.20261202.11

Copy | Download

AMA Style

Temitope OO, Ademola YM, Bisola FJ. Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm). J Dis Med Plants. 2026;12(2):70-87. doi: 10.11648/j.jdmp.20261202.11

Copy | Download

@article{10.11648/j.jdmp.20261202.11,
  author = {Osuntokun Oludare Temitope and Yusuf-Babatunde Moruf Ademola and Fapohunda Juliet Bisola},
  title = {Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm)},
  journal = {Journal of Diseases and Medicinal Plants},
  volume = {12},
  number = {2},
  pages = {70-87},
  doi = {10.11648/j.jdmp.20261202.11},
  url = {https://doi.org/10.11648/j.jdmp.20261202.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.jdmp.20261202.11},
  abstract = {This study investigated the comparative effects of natural and chemical treatments on pond water samples obtained from the AAUA Fishery, with emphasis on microbial load reduction, diversity, antibiotic susceptibility, fungal occurrence, and molecular resistance gene detection. Treatments applied included Moringa oleifera leaf powder (0.5 g and 1 g), chlorine (0.5 g and 1 g), and direct sunlight exposure, while untreated samples served as controls. Microbiological analyses were performed using serial dilution, spread plating, colony morphology, Gram staining, and biochemical characterization, with bacterial identification supported by Bergey’s Manual of Determinative Bacteriology. Fungal isolates were identified based on cultural and microscopic features, and antibiotic susceptibility was assessed using the Kirby–Bauer disk diffusion method. PCR amplification was used to detect selected antibiotic resistance genes. Results showed that 0.5 g of Moringa moderately reduced bacterial counts from 3.5 × 104 to 7.0 × 103 CFU/mL (10-3 dilution) and from 2.0 × 107 to 6.0 × 106 CFU/mL (10-6 dilution) over 6 h, while 1 g produced weaker inhibition. Sunlight treatment was more effective, lowering bacterial load from 6.0 × 104 to 7.0 × 103 CFU/mL and from 3.5 × 107 to 4.0 × 106 CFU/mL across dilutions. Chlorine was the most potent treatment, achieving complete elimination of bacterial growth within 4–6 h at both concentrations. Control samples only showed a natural decline in bacterial counts. Biochemical and colony analyses revealed diverse bacterial species, including Staphylococcus aureus, Micrococcus luteus, Bacillus spp., Aeromonas hydrophila, Enterococcus faecalis, Corynebacterium sp., Vibrio cholerae, and Listeria monocytogenes. Antibiotic susceptibility tests indicated that both Gram-positive and Gram-negative isolates exhibited multidrug resistance, with inhibition zones ranging between 10 mm and 16 mm. Fungal isolates included Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowii, Eurotium sp., and Aspergillus flavus. Molecular assays detected the presence of blaOXA and qnrA resistance genes, while blaNDM, blaTEM, blaSHV, tetA, tetB, and cmlA were not detected. These findings highlight the superior bactericidal effect of chlorine relative to Moringa oleifera and sunlight, Moringa oleifera become an alternative source to chlorine and its effects on multidrug resistant microorganisms in pond water, but also reveal the persistence of multidrug-resistant bacteria and fungi in treated pond water. The study underscores the need for integrated water treatment approaches and continuous monitoring to safeguard aquaculture productivity and public health.},
 year = {2026}
}

Copy | Download

TY  - JOUR
T1  - Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm)
AU  - Osuntokun Oludare Temitope
AU  - Yusuf-Babatunde Moruf Ademola
AU  - Fapohunda Juliet Bisola
Y1  - 2026/04/13
PY  - 2026
N1  - https://doi.org/10.11648/j.jdmp.20261202.11
DO  - 10.11648/j.jdmp.20261202.11
T2  - Journal of Diseases and Medicinal Plants
JF  - Journal of Diseases and Medicinal Plants
JO  - Journal of Diseases and Medicinal Plants
SP  - 70
EP  - 87
PB  - Science Publishing Group
SN  - 2469-8210
UR  - https://doi.org/10.11648/j.jdmp.20261202.11
AB  - This study investigated the comparative effects of natural and chemical treatments on pond water samples obtained from the AAUA Fishery, with emphasis on microbial load reduction, diversity, antibiotic susceptibility, fungal occurrence, and molecular resistance gene detection. Treatments applied included Moringa oleifera leaf powder (0.5 g and 1 g), chlorine (0.5 g and 1 g), and direct sunlight exposure, while untreated samples served as controls. Microbiological analyses were performed using serial dilution, spread plating, colony morphology, Gram staining, and biochemical characterization, with bacterial identification supported by Bergey’s Manual of Determinative Bacteriology. Fungal isolates were identified based on cultural and microscopic features, and antibiotic susceptibility was assessed using the Kirby–Bauer disk diffusion method. PCR amplification was used to detect selected antibiotic resistance genes. Results showed that 0.5 g of Moringa moderately reduced bacterial counts from 3.5 × 104 to 7.0 × 103 CFU/mL (10-3 dilution) and from 2.0 × 107 to 6.0 × 106 CFU/mL (10-6 dilution) over 6 h, while 1 g produced weaker inhibition. Sunlight treatment was more effective, lowering bacterial load from 6.0 × 104 to 7.0 × 103 CFU/mL and from 3.5 × 107 to 4.0 × 106 CFU/mL across dilutions. Chlorine was the most potent treatment, achieving complete elimination of bacterial growth within 4–6 h at both concentrations. Control samples only showed a natural decline in bacterial counts. Biochemical and colony analyses revealed diverse bacterial species, including Staphylococcus aureus, Micrococcus luteus, Bacillus spp., Aeromonas hydrophila, Enterococcus faecalis, Corynebacterium sp., Vibrio cholerae, and Listeria monocytogenes. Antibiotic susceptibility tests indicated that both Gram-positive and Gram-negative isolates exhibited multidrug resistance, with inhibition zones ranging between 10 mm and 16 mm. Fungal isolates included Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowii, Eurotium sp., and Aspergillus flavus. Molecular assays detected the presence of blaOXA and qnrA resistance genes, while blaNDM, blaTEM, blaSHV, tetA, tetB, and cmlA were not detected. These findings highlight the superior bactericidal effect of chlorine relative to Moringa oleifera and sunlight, Moringa oleifera become an alternative source to chlorine and its effects on multidrug resistant microorganisms in pond water, but also reveal the persistence of multidrug-resistant bacteria and fungi in treated pond water. The study underscores the need for integrated water treatment approaches and continuous monitoring to safeguard aquaculture productivity and public health.
VL  - 12
IS  - 2
ER  -

Copy | Download

Author Information

Osuntokun Oludare Temitope

Department of Microbiology, Adekunle Ajasin University, Akungba-Akoko, Nigeria

Contact Email

http://orcid.org/0000-0002-3954-6778
Yusuf-Babatunde Moruf Ademola

Department of Pharmacy Technician, Ogun State Polytechnic of Health and Allied Sciences, Ilese-Ijebu, Nigeria

Contact Email

http://orcid.org/0000-0002-4614-3918
Fapohunda Juliet Bisola

Department of Microbiology, Adekunle Ajasin University, Akungba-Akoko, Nigeria

Download PDF

Submit an Article

Plain Text BibTeX RIS

APA Style

Temitope, O. O., Ademola, Y. M., Bisola, F. J. (2026). Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm). Journal of Diseases and Medicinal Plants, 12(2), 70-87. https://doi.org/10.11648/j.jdmp.20261202.11

Copy | Download

ACS Style

Temitope, O. O.; Ademola, Y. M.; Bisola, F. J. Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm). J. Dis. Med. Plants 2026, 12(2), 70-87. doi: 10.11648/j.jdmp.20261202.11

Copy | Download

AMA Style

Temitope OO, Ademola YM, Bisola FJ. Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm). J Dis Med Plants. 2026;12(2):70-87. doi: 10.11648/j.jdmp.20261202.11

Copy | Download

@article{10.11648/j.jdmp.20261202.11,
  author = {Osuntokun Oludare Temitope and Yusuf-Babatunde Moruf Ademola and Fapohunda Juliet Bisola},
  title = {Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm)},
  journal = {Journal of Diseases and Medicinal Plants},
  volume = {12},
  number = {2},
  pages = {70-87},
  doi = {10.11648/j.jdmp.20261202.11},
  url = {https://doi.org/10.11648/j.jdmp.20261202.11},
  eprint = {https://article.sciencepublishinggroup.com/pdf/10.11648.j.jdmp.20261202.11},
  abstract = {This study investigated the comparative effects of natural and chemical treatments on pond water samples obtained from the AAUA Fishery, with emphasis on microbial load reduction, diversity, antibiotic susceptibility, fungal occurrence, and molecular resistance gene detection. Treatments applied included Moringa oleifera leaf powder (0.5 g and 1 g), chlorine (0.5 g and 1 g), and direct sunlight exposure, while untreated samples served as controls. Microbiological analyses were performed using serial dilution, spread plating, colony morphology, Gram staining, and biochemical characterization, with bacterial identification supported by Bergey’s Manual of Determinative Bacteriology. Fungal isolates were identified based on cultural and microscopic features, and antibiotic susceptibility was assessed using the Kirby–Bauer disk diffusion method. PCR amplification was used to detect selected antibiotic resistance genes. Results showed that 0.5 g of Moringa moderately reduced bacterial counts from 3.5 × 104 to 7.0 × 103 CFU/mL (10-3 dilution) and from 2.0 × 107 to 6.0 × 106 CFU/mL (10-6 dilution) over 6 h, while 1 g produced weaker inhibition. Sunlight treatment was more effective, lowering bacterial load from 6.0 × 104 to 7.0 × 103 CFU/mL and from 3.5 × 107 to 4.0 × 106 CFU/mL across dilutions. Chlorine was the most potent treatment, achieving complete elimination of bacterial growth within 4–6 h at both concentrations. Control samples only showed a natural decline in bacterial counts. Biochemical and colony analyses revealed diverse bacterial species, including Staphylococcus aureus, Micrococcus luteus, Bacillus spp., Aeromonas hydrophila, Enterococcus faecalis, Corynebacterium sp., Vibrio cholerae, and Listeria monocytogenes. Antibiotic susceptibility tests indicated that both Gram-positive and Gram-negative isolates exhibited multidrug resistance, with inhibition zones ranging between 10 mm and 16 mm. Fungal isolates included Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowii, Eurotium sp., and Aspergillus flavus. Molecular assays detected the presence of blaOXA and qnrA resistance genes, while blaNDM, blaTEM, blaSHV, tetA, tetB, and cmlA were not detected. These findings highlight the superior bactericidal effect of chlorine relative to Moringa oleifera and sunlight, Moringa oleifera become an alternative source to chlorine and its effects on multidrug resistant microorganisms in pond water, but also reveal the persistence of multidrug-resistant bacteria and fungi in treated pond water. The study underscores the need for integrated water treatment approaches and continuous monitoring to safeguard aquaculture productivity and public health.},
 year = {2026}
}

Copy | Download

TY  - JOUR
T1  - Sustainable Water Management in Aquaculture: Comparing Eco-Friendly and Conventional Treatment Strategies (Fish Farm)
AU  - Osuntokun Oludare Temitope
AU  - Yusuf-Babatunde Moruf Ademola
AU  - Fapohunda Juliet Bisola
Y1  - 2026/04/13
PY  - 2026
N1  - https://doi.org/10.11648/j.jdmp.20261202.11
DO  - 10.11648/j.jdmp.20261202.11
T2  - Journal of Diseases and Medicinal Plants
JF  - Journal of Diseases and Medicinal Plants
JO  - Journal of Diseases and Medicinal Plants
SP  - 70
EP  - 87
PB  - Science Publishing Group
SN  - 2469-8210
UR  - https://doi.org/10.11648/j.jdmp.20261202.11
AB  - This study investigated the comparative effects of natural and chemical treatments on pond water samples obtained from the AAUA Fishery, with emphasis on microbial load reduction, diversity, antibiotic susceptibility, fungal occurrence, and molecular resistance gene detection. Treatments applied included Moringa oleifera leaf powder (0.5 g and 1 g), chlorine (0.5 g and 1 g), and direct sunlight exposure, while untreated samples served as controls. Microbiological analyses were performed using serial dilution, spread plating, colony morphology, Gram staining, and biochemical characterization, with bacterial identification supported by Bergey’s Manual of Determinative Bacteriology. Fungal isolates were identified based on cultural and microscopic features, and antibiotic susceptibility was assessed using the Kirby–Bauer disk diffusion method. PCR amplification was used to detect selected antibiotic resistance genes. Results showed that 0.5 g of Moringa moderately reduced bacterial counts from 3.5 × 104 to 7.0 × 103 CFU/mL (10-3 dilution) and from 2.0 × 107 to 6.0 × 106 CFU/mL (10-6 dilution) over 6 h, while 1 g produced weaker inhibition. Sunlight treatment was more effective, lowering bacterial load from 6.0 × 104 to 7.0 × 103 CFU/mL and from 3.5 × 107 to 4.0 × 106 CFU/mL across dilutions. Chlorine was the most potent treatment, achieving complete elimination of bacterial growth within 4–6 h at both concentrations. Control samples only showed a natural decline in bacterial counts. Biochemical and colony analyses revealed diverse bacterial species, including Staphylococcus aureus, Micrococcus luteus, Bacillus spp., Aeromonas hydrophila, Enterococcus faecalis, Corynebacterium sp., Vibrio cholerae, and Listeria monocytogenes. Antibiotic susceptibility tests indicated that both Gram-positive and Gram-negative isolates exhibited multidrug resistance, with inhibition zones ranging between 10 mm and 16 mm. Fungal isolates included Aspergillus fumigatus, Aspergillus terreus, Aspergillus sydowii, Eurotium sp., and Aspergillus flavus. Molecular assays detected the presence of blaOXA and qnrA resistance genes, while blaNDM, blaTEM, blaSHV, tetA, tetB, and cmlA were not detected. These findings highlight the superior bactericidal effect of chlorine relative to Moringa oleifera and sunlight, Moringa oleifera become an alternative source to chlorine and its effects on multidrug resistant microorganisms in pond water, but also reveal the persistence of multidrug-resistant bacteria and fungi in treated pond water. The study underscores the need for integrated water treatment approaches and continuous monitoring to safeguard aquaculture productivity and public health.
VL  - 12
IS  - 2
ER  -

Copy | Download